Loading...
Item 13 - Plans\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\SSSSSSSSSSSSSSSSSSSSSSSSSSSSSWDSTWWWXXXOHE OHE OHE XOHEBM 404OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHED1182638.43 1STORM D RA IN MAN HOL EOHCOHCOHCPPPPPPPPPPPPPPFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLT3PT3PT3PT3P X X X FL FL FL FL FL FLFLFLFLFLFLFLFLFLFLFLFLFL 123456781X-HOABLOCK CBLOCK B1234567891011121314151617123456789123BLOCK BBLOCK BBLOCK B1X-HOA 1X-HOA BLOCK DBLOCK EBLOCK E1X-HOA 1X-HOA 1X-HOA1X-HOA1X-HOA1X-HOA1X-HOA 15' DRAINAGE EASEMENTDOC. NO. D221095079O.P.R.T.C.T.10' PEDESTRIAN EASEMENTDOC. NO. D207152978O.P.R.T.C.T.17' CITY OF SOUTHLAKEUTILITY EASEMENTVOL.8440, PG. 768D.R.T.C.T.55' HALF ROWDEDICATION45' HALF ROWDEDICATION10'10'153'127'10'135'31' B-B19'19'9'PROPOSED 20'DRAINAGE EASEMENTPROPOSED 15'SEWER EASEMENTPROPOSED 5' UTILITY EASEMENTPROPOSED 5' UTILITYEASEMENT PROPOSED 5'UTILITY EASEMENTPROPOSED 5' UTILITY EASEMENTEXISTING 20' ELECTRIC EASEMENT10' PROPOSED PRIVATEDRAINAGE EASEMENTPROPOSED 5' UTILITY EASEMENTPROPOSED 15' DRAINAGE EASEMENTPROPOSED 5' UTILITY EASEMENTEXISTING 20' UTILITY EASEMENTEXISTING 20' UTILITY EASEMENTPROPOSED 5' WALLMAINTENANCE EASEMENTPROPOSED 15'SEWER EASEMENTPROPOSED 5' WALLMAINTENANCE EASEMENT31' B-B9'10'31' B-B10'125'WEST KIRKWOODBOULEVARD(A VARIABLE WIDTH PUBLIC RIGHT-OF-WAY)WEST KIRKWOOD BOULEVARD(A VARIABLE WIDTH PUBLIC RIGHT-OF-WAY)EAST KIRKWOODBOULEVARD(A VARIABLE WIDTH PUBLIC RIGHT-OF-WAY)VICENZA DRIVE (51' RIGHT-OF-WAY)MURANO PLACE(51' RIGHT-OF-WAY)31' B-BPROPOSED EXIT ONLYGATE WITH KNOX BOX FOREMERGENCY ACCESS31' B-B25' BUILDING SETBACK15' BUILDING SETBACK R=30.0'R=30.0'R=20.0'R =20.0'R=90.0'R=90.0'R=30.0'R=30.0'R=30.0'R=30.0'R=140.0'R=140.0'R=160.0'R=160.0'R=20.0'R=20.0'R=20.0'R=25.0'R=2 5.0'R=2 0.0'R=20.0'R=40.0'R=20.0'R=20.0'R=260.0'R=40.0'R=20.0'R=160.0'R=20.0'R=110.0'R=100.0'BLOCK 4METAIRIE AT SOUTHLAKEINST. NO. D221095079O.P.R.T.C.T.BLOCK ATHRASHER ADDITIONCAB. 388-202, PG. 73P.R.T.C.T.LOT 1LOT 2CARILLON PHASE 1AINST.NO. D211101073P.R.T.C.T.CALLED 42.5091CARILLONCROWN, LLCINST.NO.DOC. NO.D222154040O.P.R.T.C.T.17' CITY OF SOUTHLAKEUTILITY EASEMENTVOL.8440, PG. 768D.R.T.C.T.15' DRAINAGE EASEMENTDOC. NO. D221095079O.P.R.T.C.T.CALLED 1.82 ACRESPANORAMA PROPERTIES, LTD.DOC. NO. D206290483O.P.R.T.C.T.N WHITE CHAPEL BLVD25' BUILDING SETBACK30' BUILDING SETBACK25' BUILDING SETBACK25' BUILDING SETBACK30' BUILDING SETBACK8' BUILDING SETBACK8' BUILDING SETBACKPROPOSED PRIVATERESIDENT GATE WITHKNOX BOX FOREMERGENCY ACCESSPROPOSED RESIDENTCALL BOXEXISTING CONCRETEDRIVEWAY USE: RESIDENTIAL25' BUILDING SETBACK30' BUILDING SETBACK30' BUILDING SETBACK30' BUILDING SETBACK80'83'ZONING: TZDL.U.D: MIXED USEZONING: SF1-AL.U.D: LOW DENSITY RESIDENTIALZONING: AGL.U.D: MIXED USEBLOCK ATHRASHER ADDITIONCAB. 388-202, PG. 73P.R.T.C.T.N89°28'39"E1663.1'S14°49'36"E162.3'N89°24'03"E508.3'N89°24'03"E460.5'N50°24'13"E106.8'∆=79°25'16"R=110.00'L=152.48'CB=N10°41'35"EC=140.56'N29°01'03"W71.7'∆=39°35'02"R=100.00'L=69.09'CB=N48°48'34"WC=67.72'∆=38°36'49"R=150.00'L=101.09'CB=N49°17'41"WC=99.19'N29°59'16"W159.1'S89°28'39"W522.4'S0°18'41"E 595.1'N52°46'11"W31.2'∆=50°18'52"R=59.00'L=51.81'CB=N67°34'52"EC=50.16'∆=32°28'09"R=81.00'L=45.90'CB=N76°30'14"EC=45.29'∆=16°39'34"R=339.00'L=98.57'CB=N68°35'56"EC=98.22'S53°09'54"E64.6'N44°32'41"E28.4'N0°18'41"W 327.7'∆=9°42'58"R=950.00'L=161.10'CB=S19°41'04"EC=160.90'S0°18'41"E 1274.6'S45°18'41"E23.9'PURYEAR PLACE (BLOCKS B AND C LOT1X - HOA)UTLEY WAY (BLOCKS D AND E LOT1X - HOA)50'50'PAE & UDE50'145'50'PAE & UDEPROPOSED RETAINING WALL50'50'30' BUILDING SETBACK25' BUILDING SETBACK30' BUILDING SETBACK25' BUILDING SETBACKPURYEAR PLACE (BLOCKS B AND C LOT1X - HOA)R=190.0'R=290.0'ZONING: AGL.U.D: MIXED USEZONING: ECZL.U.D: MIXED USEZONING: ECZL.U.D: MIXED USE125'125'80'80'81'8' BUILDING SETBACK (TYP.)30' BUILDING SETBACK30' BUILDING SETBACK93'PAE & UDEPAE & UDEPAE & UDEPAE & UDEPAE & UDEPROPOSED PRIVATERESIDENT GATE WITHKNOX BOX FOREMERGENCY ACCESSPROPOSED RESIDENTCALL BOXPROPOSED SCREEN WALL. REFERTO LANDSCAPE PLANS FOR DETAILSPROPOSED SCREEN WALL.REFER TO LANDSCAPEPLANS FOR DETAILSBY DATE REVISIONSNo.DATESHEET NUMBERCHECKED BY: SCALE: DESIGNED BY: DRAWN BY: KHA PROJECT 6/24/2026 PHONE: 972-770-1300 FAX: 972-239-3820 WWW.KIMLEY-HORN.COM TX F-928 © 2026 KIMLEY-HORN AND ASSOCIATES, INC. LAST SAVED 6/24/2026 10:47 AMPLOTTED BY BORAWSKI, ALINA 6/24/2026 10:52 AMDWG PATH C:\ACC\ACCDocs\Kimley-Horn\067545015_TRADEMARK SOUTHLAKE\Project Files\CAD\Private Single Family\PlanSheetsDWG NAME C-Site-Plan.dwg , [ OVERALL SITE PLAN ]IMAGESXREFS xArch-PSF : xBase-PSF : xEsmt-PSF : xExBase-PSF : xExUtil-PSF : xHardscape-PSF : xLabel-PSF : xPlant-PSF : xStrm-PSF : xUtil-PSF : x22X34-PSF : xBase-GI : xBase-MI : xBase-PC : xBndry-MR : xDryUtility-PC : xEsmt-GI : xExBase-MR : xStrm-GI : xStrm-PC : xUtil-GI : xUtil-MI : xUtil-PC : xUtil-SF : xHatch-PSF : xGrad-SF : xStrm-SF : xHard 13455 NOEL ROAD, TWO GALLERIA OFFICE TOWER, SUITE 700, DALLAS, TX 75240 AS NOTED ERG AGB CMDCITY OF SOUTHLAKE, TEXAS SHIVERS' FARM PRIVATE SINGLE FAMILY 067545015ENGINEER / SURVEYOR / APPLICANT /LANDSCAPE ARCHITECT / IRRIGATOR:KIMLEY-HORN AND ASSOCIATES, INC.13455 NOEL ROAD, TWO GALLERIA OFFICETOWER, SUITE 700, DALLAS, TX. 75240PHONE: (972) 910-2931CONTACT: CHRIS DELLS, P.E.40.20 ACRESJAMES J. WEST SURVEY,ABSTRACT NO. 1620CITY OF SOUTHLAKE, TARRANT COUNTY, TEXASSUBMITTED JUNE 29, 2026OWNER:SHIVERS FAMILY PARTNERSHIP1800 N WHITE CHAPEL BLVDSOUTHLAKE, TX 76092-3617CONTACT: REBECCA UTLEYSITE PLANTRADEMARK SOUTHLAKECITY CASE NO. ZA26-00XXDEVELOPER:TRADEMARK PROPERTY COMPANY1701 RIVER RUN #500FORTH WORTH, TX 76107CONTACT: BLAKE BICKMOREEMAIL: BBICKMORE@TRADEMARKPROPERTY.COMOVERALL SITE PLANC-1001.ALL SIGNAGE IS APPROVED VIA SEPARATE PERMITTING PROCESS2.DUMPSTER ENCLOSURES SHOULD NOT BE SEEN FROM THE PUBLICRIGHT-OF-WAY. SCREENING OF THE DUMPSTERS SHALL BE OF THE SAMEMASONRY MATERIAL AS THE PRIMARY STRUCTURE AND BE A MINIMUM OFEIGHT (8) FEET IN HEIGHT. SOLID METAL GATES SHALL BE AFFIXED TO THEOPENING AND SHALL BE CLOSED AT ALL TIMES EXCEPT WHEN BEINGSERVICED3.ALL LIGHT SOURCES, INCLUDING WALL PACKS, SHALL BE FULL CUT-OFFS (I.E.RECESSED/SHIELDED)4.NO OVERHEAD UTILITIES ARE PERMITTED ON THE SUBJECT PROPERTY5.ALL STRIPING IN PARKING LOTS SHALL BE WHITE6.HANDICAPPED ACCESS RAMPS SHALL BE PAINTED OR CONSTRUCTED OFCONTRASTING COLORS FROM THE STANDARD PAVEMENT BUT SHALL NOT BEIN COLORS THAT ARE CONSIDERED BRIGHT, NEON, OR GARISH7.FIRE APPARATUS ACCESS ROADS TO BE AN ALL-WEATHER SURFACE,ASPHALT OR CONCRETE, 24 FEET WIDE AND ABLE TO SUPPORT THEIMPOSED LOADS OF FIRE APPARATUS. (MINIMUM OF 85,000 POUNDS GVW)CITY SITE PLAN NOTESNORTHVICINITY MAP(NOT TO SCALE)VICINITY MAPSITESITE PLAN FOR CITY REVIEWONLY TO ILLUSTRATECOMPLIANCE WITH ZONINGAND DEVELOPMENTSREGULATIONS. IT IS NOTINTENDED FORCONSTRUCTION PURPOSES.(TYP.)LEGENDSMHPROPERTY LINEPROPOSED FIRE HYDRANTPROPOSED CURB INLETPROPOSED SANITARY SEWER MANHOLEPROPOSED RETAINING WALLTYPICALPEDESTRIAN ACCESS EASEMENT & UTILITYDRAINAGE EASEMENTHEAVY DUTY CONCRETE PAVEMENTSIDEWALK BUILT BY THE HOME BUILDERSIDEWALK BUILT BY THE DEVELOPERFHCI0GRAPHIC SCALE IN FEET603060120PAE & UDE8'8'VARIESVARIES 125' MIN.80' MIN.TYPICAL LOTDIMENSION DETAIL(SOUTHERN TRACT)NTS25' MIN 30' MIN.8'8'VARIESVARIES 145' MIN.83' MIN.TYPICAL LOTDIMENSION DETAIL(NORTHERN TRACT)NTS25' MIN 30' MIN. SYMBOLCOMMON / BOTANICAL NAMECONT.SIZEQTYREMARKSTREESEmpire Live Oak / Quercus virginana4" cal12`-14` ht24B&B, NURSERY GROWN, MATCHED, FULL, WELL-BRANCHED,STRONG CENTRAL LEADER, 7` CLEAR AT SIDEWALKS, 14`CLEAR AT FIRELANEShumard Oak / Quercus shumardii4" cal12`-14` ht10B&B, NURSERY GROWN, MATCHED, FULL, WELL-BRANCHED,STRONG CENTRAL LEADER, 7` CLEAR AT SIDEWALKS, 14`CLEAR AT FIRELANEFLOWERING TREESTuscarora Crape Myrtle / Lagerstroemia indica x fauriei 'Tuscarora'65 gal10`-12` ht39CONTAINER, NURSERY GROWN, MATCHED, FULL,WELL-BRANCHED, MULTI-TRUNK (3 MIN.), TREE FORMSYMBOLCOMMON / BOTANICAL NAMECONT.SIZESPACINGQTYREMARKSGROUND COVERSBermuda Grass / Cynodon dactylonsod111,360 sfREFER TO SPECIFICATIONSPLANT SCHEDULE SINGLE FAMILYUTLEY WAYUTLEY WAYPURYEAR PLACEPURYEAR PLACEPURYEAR PLACEPURYEAR PLACE 8"W12"W12"W12"W12"W12"W12"WX X X W WWWSS SSSS SS SSSSSSSSSS SSWWWSSSSSSSSSSSSSSSSSSSS SS SS SS SSSSSSSSSSSSSSSSSSSSSSSSFLFLFL FLWWWWWWWWSSSUGEUGE UGE UGE UGEUGEUGEUGEUGEUGEUGE UGE UGE GASGASGASGASGASGASGASGASGASGASGASGASGAS GA S GAS GAS GAS GAS GAS GAS GASGAS GASGASGASGASGASGASGASGASGASGASGASGAS GAS GAS GAS GAS GASGASGASGASGASGASGASGASGASGASGASGASGASGASGASGASGASGASGASGAS GAS GAS GAS GASGASGAS GASGASGAS GAS GAS GAS GAS GASGASGASGASGASGASGASGASGAS OHCUGEUGEUGEUGEUGEUGEUGEUGEU G E UGEUGEUGEUGEUGEUGEUGEGAS GAS GAS UGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGC UGC UGC UGC UGCUGCUGC UGC UGC UGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGC UGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEPPPPPPPPPPPPP PFL FL FL FL FL FL FL FLFLFLFLFLFLFLFLFL FL FL FL FL FL FL FL FL T3PT3PT3P8"SS8"SS8"SS8"W8"W8"W8"W8"W8"W8"W8"W8"W 8"W SSS8"W8"W8"W8"W8"W\\\\\\\\\\\\\\\\\\\\\\ \\\\\\\\\\\\ \\\\\\\\\\\\\\ \\\\\\\\\\\\\\\\\\\\ \\ \\WintercreeperGiant LiriopeTexas SotolBlonde Ambition Blue GramaRed YuccaGulf Stream Heavenly BambooAsian Jasm ine Princ e ton Am e r ic a n E lm L a c eb a r k E lm Dwa r f Y aupo nDwa r f Y aupo n Empir e L i v e O a kBerm ud a G rass E x i s t i n g T r e e s T o Rem a in (7 )Asi a n J a sm i n e \\\\\\\\\\ \\ \\\\\\\\\\\\\\\\ \\ \ \\\\\\\ \ \ \ \\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\ \ \\ \\\\\\\\\\\\\\\\ \\ \\ \\ \\ \\ \\ \\\\\\\\\\\\ \\ \\ \ \ \\\\\\\\\\\\\\\\\\\\\\Bermuda GrassBermuda GrassTuscarora Crape MyrtleBermuda GrassEmpire Live OakBermuda GrassGiant LiriopeGiant LiriopeDwarf PodocarpusRegal Mist® Pink Muhly GrassWintercreeperTexas SotolBlonde Ambition Blue GramaChaste TreeWintercreeperTexas RedbudGiant LiriopeOHL OHL OHL OHL OHL OHL OHL OHL OHL OHL OHL OHL OHL OHLOHLOHLOHLOHLOHLOHLOHLOHLOHLCBL CBL CBL CBL CBL CBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBL GAS GASGASGASGASGASGASGASGASOHLOHLOHLOHLOHL3316333433353336333733383339334033413352335333543377 337833793380338133823383338433853386338733883389339033913392339333943395339633973398339934003401340234033404340534063407340834093410341134123413341434153416LIMIT OF WORKLIMIT OF WORKLIMIT OF WORKLIMIT OF WORKLIMIT OF WORKLIMIT OF WORKLIMIT OF WORKLIMIT OF WORK AL0.2VEHICULAR & PEDESTRIAN GATECALLBOXSCREENING FENCECALLBOXAL0.2VEHICULAR & PEDESTRIAN GATECALLBOXSCREENING FENCECALLBOXSCREENING FENCEAL0.2VEHICULAR & PEDESTRIAN GATEBY DATE REVISIONSNo.DATESHEET NUMBERCHECKED BY: SCALE: DESIGNED BY: DRAWN BY: KHA PROJECT 6/25/2026 PHONE: 972-770-1300 FAX: 972-239-3820 WWW.KIMLEY-HORN.COM TX F-928 © 2026 KIMLEY-HORN AND ASSOCIATES, INC. LAST SAVED 6/25/2026 4:19 PMPLOTTED BY BRIM, JESSE 6/25/2026 5:06 PMDWG PATH C:\ACC\ACCDocs\Kimley-Horn\067545015_TRADEMARK SOUTHLAKE\Project Files\CAD\Private Single Family\PlanSheetsDWG NAME L-Landscape Plan.dwg , [ L-01 ]IMAGESXREFS xTree : xSurvey : xHard : xPlant : xSite-SF : xStrm-SF : xUtil-SF : xBase-PC : xDryUtility-PC : xStrm-PC : xUtil-PC : xBase-GI : xStrm-GI : xUtil-GI : xArch-MI : xBase-MI : xArch-PC : xEsmt-MI : xUtil-MI : x22X34-PSF : Gate Details : xGrad-SF 13455 NOEL ROAD, TWO GALLERIA OFFICE TOWER, SUITE 700, DALLAS, TX 75240 AS NOTED ERG AGB CMDCITY OF SOUTHLAKE, TEXAS SHIVERS' FARM PRIVATE SINGLE FAMILY 067545015Landscape PlanAScale: 1"=60'NORTHLANDSCAPE PLANL-010'60'120'Scale: 1" = 60'-0"PDF PDF JSB 06.29.2026FOR REVIEW ONLYNot for construction or permit purposesP.L.A.L.A. No.DatePaul D. Freeland245806/29/26 Vehicular & Pedestrian GateAScale: 1/4" = 1'-0"6'-0"15'-10" FIELD VERIFY15'-10" FIELD VERIFY1'-9"1'-10"1'-10"3'-0"1'-9"1'-10"1'-10"3'-0"32'-7" FIELD VERIFYFINISH GRADE ABOVE (REF. CIVIL PLANS, TYP.)VEHICULAR GATE MOTOR, ATTACHMENTSTYLE & TYPE BY OTHERS (BEYOND)VEHICULAR DRIVE AISLE; REF. CIVIL PLANSNOTE:1.GATE SHALL MEET ALL APPLICABLE ASTM F2200 ANDUL 325 STANDARDS FOR SLIDING GATE SYSTEMS.2.CONTRACTOR TO PROVIDE STRUCTURAL ENGINEEREDSHOP DRAWINGS FOR APPROVAL BYOWNER/LANDSCAPE ARCHITECT PRIOR TO FABRICATION.VEHICULAR SWING GATE; REF. SHOP DRAWINGSMASONRY COLUMNPEDESTRIAN GATE; REF. SHOP DRAWINGS2'-0" BY DATE REVISIONSNo.DATESHEET NUMBERCHECKED BY: SCALE: DESIGNED BY: DRAWN BY: KHA PROJECT 6/24/2026 PHONE: 972-770-1300 FAX: 972-239-3820 WWW.KIMLEY-HORN.COM TX F-928 © 2026 KIMLEY-HORN AND ASSOCIATES, INC. LAST SAVED 6/24/2026 10:53 AMPLOTTED BY BRIM, JESSE 6/24/2026 10:54 AMDWG PATH C:\ACC\ACCDocs\Kimley-Horn\067545015_TRADEMARK SOUTHLAKE\Project Files\CAD\Private Single Family\PlanSheetsDWG NAME L-Landscape Plan.dwg , [ L-02 ]IMAGESXREFS xTree : xSurvey : xHard : xPlant : xSite-SF : xStrm-SF : xUtil-SF : xBase-PC : xDryUtility-PC : xStrm-PC : xUtil-PC : xBase-GI : xStrm-GI : xUtil-GI : xArch-MI : xBase-MI : xArch-PC : xEsmt-MI : xUtil-MI : x22X34-PSF : Gate Details : xGrad-SF 13455 NOEL ROAD, TWO GALLERIA OFFICE TOWER, SUITE 700, DALLAS, TX 75240 AS NOTED ERG AGB CMDCITY OF SOUTHLAKE, TEXAS SHIVERS' FARM PRIVATE SINGLE FAMILY 067545015 LANDSCAPE DETAILSL-02PDF PDF JSB 06.29.2026FOR REVIEW ONLYNot for construction or permit purposesP.L.A.L.A. No.DatePaul D. Freeland245806/29/26 LANDSCAPE SPECIFICATIONSL-03PLANTING (CONT.)SPECIFICATIONS:LANDSCAPE MAINTENANCEPART 1 -GENERAL1.1SECTION INCLUDESA.Furnish all labor, material, equipment, related services and supervision necessary for or incidental to theinstallation of the trees, plants and groundcovers as shown or indicated on the Drawings and/or as specified.B.Work Included:1.Trees.2.Shrubs.3.Groundcovers.4.Steel Edging.5.Mulching.6.Bed Preparation.1.2REFERENCE STANDARDSA.American Standard for Nursery Stock, Edition approved May 2, 1986 by American National StandardsInstitute, Inc. - plant material.1.3SUBMITTALSA.Delivery Receipts and Invoices: Submit original delivery receipts and invoices for materials used.B.Product Data: Submit manufacturer's product data sheets for proprietary products in accordance with Section01 33 00.C.Samples:1.Submit three samples each of small trees and shrubs for the Architect's approval. When approved, tagand maintain as representative samples for finally installed plant materials. Samples may be used tocomplete installation provided they remain tagged until final acceptance of entire installation.2.Submit photos of trees and source nursery information to the Architect for review prior to tree tagging.Architect will tag trees at source nursery prior to project delivery.3.Submit for approval sufficient representative quantities of sandy loam, composted organic material, steeledging, mulch, peat moss and crushed rock. Samples shall be approved by the Architect before use onproject.D.Soil Fertility Test Reports:1.Submit analysis, test results and corrective recommendations to Architect.2.Two tests required of existing soil taken at different locations on the project site as directed by theArchitect.3.One test required of the specified composted organic material mixed in equal parts with the existingtopsoil.1.4DELIVERY, STORAGE AND HANDLINGA.Deliver packaged materials in containers showing weight, analysis and name of manufacturer.B.Protect materials from deterioration during delivery and while stored at the site.1.5PROJECT CONDITIONSA.Site Inspection:1.It is the bidding contractors' responsibility to review all site conditions, as they relate to the proposedproject, prior to submission of a bid. Any issues or concerns will be submitted to the Architect prior tobidding. Submission of a bid will indicate that the bidding contractor has made a site inspection.B.Utilities:1.Determine locations of underground utilities and perform work in a manner which will avoid possibledamage. Do not permit heavy equipment such as trucks to damage utilities. Hand excavate, as requiredto minimize possibility of damage to underground utilities. Maintain grade stakes until removal isdirected.2.Coordinate with irrigation work to prevent damage to temporary risers of underground sprinkling systemand obstruction of work located in landscape areas.C.Protections:1.Do not move equipment over existing or newly placed structures without the Architect's approval.2.Provide board roading as required to protect paving and soft soil.3.Protect other improvements from damage, with protection boards, ramps and protective sheeting asrequired.4.Locate and stake irrigation heads, valve risers and equipment prior to beginning soil preparation work.5.During work and maintenance period, maintain topsoil and prepared soil in place at established grades.Replace topsoil, prepared soil and mulch due to erosion.D.Delivery and Storage:1.Store materials in area covered with protective sheeting.2.If balled plants cannot be planted within 24 hours after delivery to site, protect root balls by heeling inwith sawdust or other approved material.1.6SUBSTANTIAL COMPLETION & PROJECT CLOSEOUTA.A Certificate of Substantial Completion will be issued when the Work performed under the Contract has beenreviewed and found, to the Architect's best knowledge, information and belief, to be substantially complete.Substantial Completion is the stage in the progress of the Work when the Work or designated portion thereof issufficiently complete in accordance with the Contract Documents so the Owner can occupy or utilize the Workfor its intended use. The date of Substantial Completion of the Project or portion thereof is also the date ofcommencement of applicable guarantees as specified.B.A list of items to be completed or corrected will be attached to the Certificate of Substantial Completion. Thefailure to include any items on such list does not alter the responsibility of the Contractor to complete all Workin accordance with the Contract Documents.C.The Contractor will complete or correct the Work on the list of items within a specific number of days asshown on the Certificate of Substantial Completion.D.Upon completion and re-inspection of all corrected items listed, the Architect will recommend to the Ownerthat the work of this Section is ready for final acceptance.1.7QUALITY ASSURANCEA.General: Comply with applicable Federal, state, county and local regulations governing landscape materialsand work.B.Installer Qualifications: The bidding company will specialize in landscape installation with 5 years documentedexperience. The contractor will staff the project with a competent superintendent and the necessary assistantsas approved by the Architect. The superintendent will not be changed except with the consent of the Architectand Owner. The superintendent must have a minimum 5 years' experience with similar projects.C.Personnel: Employ only experience personnel who are familiar with the required work. Provide adequatesupervision by a qualified foreman.1.8GUARANTEED.Guarantee plants and trees for one year after date of Final Acceptance. Replace dead materials and materialsnot in vigorous, thriving condition as soon as weather permits and on notification by the Architect. Replaceplants, including trees, which have partially died thereby damaging shape, size or symmetry.E.Replace plants and trees with same kind and sizes as originally planted, at no cost to the Owner. At directionof the Architect, trees may be replaced at start of next year's planting or digging season. In such cases,remove dead trees immediately. Protect irrigation system and other piping, conduit or other work duringreplacement. Repair damage immediately.1.9PROGRESS MEETINGSA.Contractor shall attend all progress meetings as requested by the Architect/Owner during installation.1.10QUANTITY VERIFICATIONA.The bidding contractor is responsible for the inclusion of all materials, labor, and equipment as outlined inthe plans and specification. The plant list is provided to the bidding contractor as a convenience and thequantities are approximate.B.VERIFICATION OF ALL QUANTITIES IS THE SOLE RESPONSIBILITY OF THE BIDDING CONTRACTOR. Anydiscrepancies must be reported to the Landscape Architect prior to submittal of bid.C.The Contractor is required to install the specified type and quantity of composted organic material purchasedfrom the specified supplier. Soil Building Systems will e-mail the Architect, as orders are being placed, forverification that the specified material, quantity and supplier are being used.PART 2 -PRODUCTS2.1PLANTSA.General: Plants shall be well-formed No. 1 grade or better nursery stock in accordance with requirements ofreference standards, subject to the Architect's approval. Listed plant heights are from tops of plant balls to thenominal tops of plants.B.Shrubs and Groundcovers: Nursery grown, healthy, vigorous, bushy, well branched, of normal habit ofgrowth for species, free from disease, insects, eggs and larvae. Specified sizes shall be before pruning, andplants shall be measured with their branches in normal position. The Architect prior to installation will approveall plants.C.Ornamental and Shade Trees: Healthy, vigorous, full branches, well shaped, trunk diameter and heightrequirements as specified. Balls shall be firm, neat, slightly tapered and well burlaped. Trees with loose orbroken balls at time of planting shall be rejected. Each tree will be approved by the Architect prior toinstallation. Balls shall be 10 inches in diameter for each 1 inch of caliper. All balled and burlaped trees andshrubs will be dug and stored for a minimum of 60 days prior to planting on this project. All trees shall haveexcess soil removed from the top of the root ball so the root flare is exposed.D.Caliper: Trees 4 inches and less are measured 6 inches above top of root ball. Trees over 4 inches aremeasured 12 inches above top of root ball.E.Trees connected to stakes at the nursery are not acceptable and will be rejected.2.2SOIL PREPARATION MATERIALSA.Sandy Loam: Fertile, dark sandy loam free of rubble, stones, lumps, plant roots and reasonably free of weeds.Loam containing nut grass or Dallisgrass shall be rejected.B.Commercial Fertilizer: Complete fertilizer, uniform in composition, dry and free flowing. Deliver to site inoriginal unopened containers, each bearing manufacturer's guaranteed statement of analysis. Lesco 14-14-14landscape and ornamental fertilizer with micronutrients.C.Composted Organic Material: Soil Building Systems -or- The Organic Recycler`Ph Balanced' Compost with aph of 5.5 to 6.5 and shall be free of treated or used lumber, pine bark or mushroom compost waste. 97% Ofthe material shall pass through a .5 inch screen and 100% shall pass through a .75 inch screen.2.3MISCELLANEOUS MATERIALSA.Crushed Rock: Washed .75 inch to 1.5 inches in diameter.B.Tree Staking: Arborguy @ (866) 272-6771,1.Trees up to 4 inch caliper - Arborguy PRO40HD.2.Trees up to 6 inch caliper - Arborguy PRO60HD.C.Mulch: Partially decomposed fine shredded Cedar mulch.D.Filter Fabric: Mirafi 140N by Celanese Fibers Marketing Co. or equal.E.Fertilizer Tablets: BioPlex Planting Tablets, 15 gram, 12-8-8. BioPlex @ 1-800-441-3573F.Steel Edging: 3/16 inch x 4 inch, with 16” tapered steel stakes, 30” O.C. and the finish will be hot dippedgalvanized. The J.D. Russell Company @ (800) 580-6872 or approved equal.G.4 inch PVC pipe and cap CUA 55 200.H.Water: Provided by Owner.PLANTING1.2SUBMITTALSC.Delivery Receipts and Invoices: Submit original delivery receipts and invoices for materials used.D.Product Data: Submit sample label or specification of fertilizer.E.Certificate: Submit State Certificate stating analysis of purity and germination of seed.F.Certificate: Submit State Certificate stating variety and purity of grass sprigs.G.Certificate: Submit State Certificate stating variety and purity of grass sod.H.Application Log: Submit daily log sheets of hydro mulch operations with the following information:1.Seed type and amount.2.Fertilizer analysis and amount.3.Seeding additive type and amount.4.Area covered.5.Equipment used-capacity and license number.6.Signature of nozzle man.I.Soil Fertility Test Reports:1.Submit analysis, test results and corrective recommendations to Architect.2.Two tests required of existing soil taken at different locations on the project site as directed by the Architect.1.3PROTECTIONA.Protect paving surfaces, curbs, utilities, plant materials, and other existing improvements from damage by heavyequipment.B.Locate and stake irrigation heads, valve risers and equipment prior to beginning soil preparation work.C.Exercise care to prevent the hydromulch slurry from being sprayed inside reservoir basins or drainage ditches andchannels which may impede the free flow of rain water runoff or irrigation water.D.Clean paving and other surfaces of over-spray and spillage of hydro mulch slurry.E.During work and maintenance period, maintain topsoil in place at established grades. Replace topsoil and grasslosses due to erosion.F.Protect in place work from damage by heavy equipment. Prepare, grade, level and replant damaged areas.1.4SUBSTANTIAL COMPLETION & PROJECT CLOSEOUTA.A Certificate of Substantial Completion will be issued when the Work performed under the Contract has beenreviewed and found, to the Architect's best knowledge, information and belief, to be substantially complete.Substantial Completion is the stage in the progress of the Work when the Work or designated portion thereof issufficiently complete in accordance with the Contract Documents so the Owner can occupy or utilize the Work for itsintended use. The date of Substantial Completion of the Project or portion thereof is also the date of commencementof applicable guarantees as specified.B.A list of items to be completed or corrected will be attached to the Certificate or Substantial Completion. The failure toinclude any items on such list does not alter the responsibility of the Contractor to complete all Work in accordancewith the Contract documents.C.The Contractor will complete or correct the Work on the list of items within a specific number of days as shown onthe Certificate of Substantial Completion.D.Upon completion and re-inspection of all corrected items listed, the Architect will recommend to the Owner that thework of this Section is ready for final acceptance.1.5QUALITY ASSURANCEA.General: Comply with applicable Federal, State, County and local regulations governing landscape materials andwork.B.Personnel: Employ only experienced personnel who are familiar with the required work. Provide supervision by aqualified foreman.1.6GUARANTEEA.Guarantee lawns and grasses for one year after date of Final Acceptance which is described in paragraph 1.7.D. Atthe end of this guarantee period, all lawn and grass areas will have achieved coverage of the specified grass at adensity of 100% coverage, free of weeds, undesirable grass species, disease and insects. Replace dead materialsand materials not in vigorous, thriving condition as soon as weather permits and on notification by the Architect.B.Replace lawns and grasses with same kind as originally planted, at no cost to the Owner. Protect irrigation systemAnd other piping, conduit or other work during replacement. Repair damage immediately.1.7JOB CONDITIONSA.Do not install seed or sod on saturated or frozen soil.B.Sod installation shall be subject to suitability of the weather and other conditions affecting sod growth.1.8PROGRESS MEETINGSA.Contractor shall attend all progress meetings as requested by the Architect/Owner during installation.1.9QUANTITY VERIFICATIONA.The bidding contractor is responsible for the inclusion of all materials, labor and equipment as outlined in the plansand specification. The plant list is provided to the bidding contractor as a convenience and the quantities areapproximate. VERIFICATION OF ALL QUANTITIES IS THE SOLE RESPONSIBILITY OF THE BIDDING CONTRACTOR.Any discrepancies must be reported to the Architect prior to submittal of bid.PART 2 -PRODUCTS2.1GRASSA.Bermuda grass Seed: Cynodon dactylion (Common Bermuda Grass). Seed shall be harvested within one year priorto planting, free of Johnson grass, field bind weed, dodder seed and free of other weed seed to the limits allowableunder the Federal Seed Act and applicable seed laws. The seed shall not be a mixture. The seed shall be hulled, extrafancy grade, treated with fungicide, and have a germination and purity that will produce, after allowance for FederalSeed Act tolerances, a pure live seed content of not less than 85%, using the formula: purity % times (germination %times plus hard or sound seed %). Seed shall be labeled in accordance with U.S. Department of Agriculture rules andregulations.B.Annual Rye Grass Seed: Lolium multiflorum (Annual Rye Grass). Seed shall be harvested within one year prior toplanting, free of Johnson grass, field bind weed, dodder seed and free of other weed seed to the limits allowableunder the Federal Seed Act and applicable seed laws. The seed shall not be a mixture. The seed shall be un-hulled,extra fancy grade, treated with fungicide and have a germination and purity that will produce, after allowance forFederal Seed Act tolerances, a pure live seed content of not less than 90%, using the formula: purity % times(germination % times plus hard or sound seed %). Seed shall be labeled in accordance with U.S. Department ofAgriculture rules and regulations.C.Seed used shall be labeled and furnished in sealed standard containers with signed copies of a statement from thevendor certifying that each container of seed delivered is fully labeled and is in conformance with the requirements ofthese specifications.D.Seed that has become wet, moldy or otherwise damaged in transit or storage will not be accepted.E.Bermuda, Saint Augustine and Zoysia Sod:1.Sod shall be nursery grown on cultivated agricultural soils. Sod shall have been mowed regularly and carefullyand otherwise maintained from planting to harvest.2.Sod shall be of species indicated.3.Thickness of Cut: Sod shall be cut to the supplier's standard width and length. Maximum allowable deviationfrom standard widths and lengths shall be plus or minus .25 inches on width and plus or minus 5% on length.4.Broken strips and torn or uneven ends will not be accepted.5.Strength of Sod Strips: Sod strips shall be strong enough to support their own weight and retain their size andshape if suspended vertically when grasped in the upper 10% of the section.6.Moisture Content: Sod shall not be harvested or transplanted when moisture content (excessively wet or dry)may adversely affect its survival. Sod shall be stored in a compact group to prevent drying out or freezing.7.Time Limitations: Sod shall be harvested, delivered and transplanted within a 30 hour period unless a suitablepreservation method is approved by the Architect prior to delivery. Sod not transplanted within this period shallbe inspected for approval by the Landscape Architect prior to its installation.8.Thatch: Sod shall be free of thatch.9.Diseases. Nematodes and Insects: Sod shall be free of diseases, nematodes and soil-borne insects.10.Weeds: Sod shall be free of objectionable grassy and broadleaf weeds. 2.2FERTILIZERA.General:1.Fertilizer shall be commercial product, uniform in composition, free flowing, and suitable for application withapproved equipment.2.Deliver fertilizer to site in fully labeled original containers.3.3.Fertilizer which has been exposed to high humidity and moisture has become caked or otherwisedamaged, making it unsuitable for use, will not be acceptable.B. Hydro Mulch Initial Application:1.16% nitrogen2.20% phosphoric acidC. 0% potashHydro Mulch Second Application:1.15% nitrogen (50% SCU or UF)2.5% phosphoric acid3.10% potash plus a minimum of 8% sulphur and 4% iron plus micronutrients.B. Sod Initial Application:4.17% nitrogen5.17% phosphoric acid6.17% potashE.Sod Second Application (Bermuda Grass Only):1.21% nitrogen2.0% phosphoric acid3.0% potashPART 1 -GENERAL1.1SECTION INCLUDESA.This section specifies all soil material designated as Topsoil or Lightweight Topsoil on the drawings or in thespecifications.1.2SUBMITTALSA.Samples1.Provide (3) 1-gallon samples for each soil type.2.Each sample to be a composite of five to seven (5-7) sub-samples taken the full depth of proposed source. Onstockpiles, discard upper 6 inches of soil before sampling.3.Place samples in plastic bags, seal, and place in second paper bag, and label.B.Test Reports1.Prior to starting work, submit 2 certified copies of soil test reports to the Architect for approval.2.Costs of all tests to be borne by the Contractor.1.3QUALITY ASSURANCEA.All soil samples and testing shall comply with procedures specified in:1.U.S.D.A. Ag. Handbook 60: Diagnosis and Improvement of Saline and Alkali Soils.B.Testing Laboratories1.Certified facilities normally engaged in agronomic soil testing shall be utilized.A.Required Topsoil Tests1.Chemical analysis indicating:a.Fertility: pH, nitrate nitrogen, ammonia nitrogen, phosphate phosphorous, potassium, calcium, magnesium,zinc, iron, and manganese.b.Suitability: total salinity, boron, sodium, potassium, calcium, magnesium, chloride, and sulfate.2.Physical properties include:a.Organic contentb.Particle size distributionPART 2 -PRODUCTS2.1TOPSOILA.On-grade topsoil for the work shall conform to the requirements included in this Section1.A natural, friable, loamy soil, typical of local topsoil which produces heavy vegetative growth, free from subsoil,weeds, sods, stiff clay, stones larger than ½ inch, toxic substances, debris, or other substances which may byharmful to plant growth.2.The pH range shall be 6.5 to 7.5.B.Grading Analysis: Two inch sieve, 100 percent passing. Number 4 sieve, 90 percent minimum passing. Number 10sieve, 80 percent minimum passingC.Sand, silt and clay content:1.Sand: 20 to 75 percent.2.Silt: 10 to 60 percent.3.Clay: 5 to 30 percent.D.All topsoil shall be free from all herbicides and insecticides which may adversely affect growth of lawn or planting, orwhich may contain toxic materials.E.Do not deliver in muddy condition.F.The Contractor shall not use materials which do not conform to these criteria. At the discretion of the LandscapeArchitect, such material can either by amended to meet these requirements, or will be removed from the site and replacedwith suitable material as specified.2.2LIGHTWEIGHT TOPSOILA.Tree/Shrub - Lightweight Topsoil for tree and shrub areas on roof deck shall be:1.Product: Soil Building Systems “Deep Tree Mix.” (Refer to Manufacturers specifications).2.Alternate lightweight topsoil mix will be considered per approval by Landscape Architect.B.Turf - Lightweight Topsoil for turf areas on roof deck shall be:1.Product: Soil Building Systems “Lightweight Turf Soil” (Refer to Manufacturers specifications).2.Alternate lightweight topsoil mix will be considered per approval by Landscape Architect.PART 3 -EXECUTION3.1 Not UsedTOP SOILPART 1 -GENERAL1.1SECTION INCLUDESA.Landscape Maintenance Contractor shall furnish all labor, equipment, chemicals and fertilizernecessary to maintain newly planted landscaping leaving plants in a vigorous, healthy state throughthe end of the stated maintenance period. Maintenance shall consist of watering, weeding, fertilizing,disease and insect pest control, pruning, aerating, protective spraying and any other proceduresconsistent with good horticultural practice necessary to insure normal, vigorous and healthy growthof all landscape materials under this contract. Trash and debris will be removed from the projectduring each regular site visit. Maintenance shall begin following final acceptance of the landscapeinstallation.B.The Landscape Maintenance Contractor shall be responsible for the use of all his/her materials, laborand equipment. Injury to plant material caused by such maintenance, labor and equipment shall becorrected and repaired by the Landscape Maintenance Contractor at his/her expense. This includesboth reseeding areas damaged by tractor treads when mowing is conducted at an inappropriate time,as determined by the Owner or his/her agent, and replacement of any plants, hardscape, or otheramenities on the site when damaged by the Contractor's equipment, materials or agent(s).1.2INSURANCEA.Contractor shall provide to the Owner, at his own expense, evidence of adequate Workman'sCompensation, General Liability and Property Damage Liability, subject to approval of the Owner.1.3CLEAN UPA.All debris, tools, surplus materials, equipment, etc. shall be removed after each regular visit from themaintenance crew. The site shall be left in a neat, acceptable condition such as to meet the approvalof the Owner.1.4LICENSE REQUIREMENTSA.Pesticide: The Contractor shall be a licensed pesticide applicator or employ a licensed certifiedpesticide applicator for the treatment of insects and diseases as required by the Texas PesticideLaws and Regulations of the Texas Department of Agriculture. The Owner may requiredocumentation of such certification as necessary for his records.B.Herbicide: The Contractor shall possess a permit or employ a person who possesses a permit toapply herbicide as required b the Texas Herbicide Law of the Texas Department of Agriculture. TheOwner may require documentation of such certification as necessary for his records.C.Irrigation: The Contractor shall possess an irrigator's license issued by the State of Texas and theTexas Board of Irrigators or employ such a licensed irrigator to perform the irrigation systemmaintenance. The irrigation system shall be maintained under the supervision of the licensedirrigator who shall be on the site at all times during this work.The Owner may require documentation of such license for his records. The Contractor shall verifyand adhere to the requirements and codes of any controlling utility authorities.PART 2 -PRODUCTS2.1COMMERCIAL FERTILIZERA.Complete fertilizer, uniform with composition, dry and free flowing, delivered to site in originalunopened containers, each bearing manufacturer's guaranteed statement of analysis.1.Shrubs & groundcover at 10-20-10 analysis.2.Turf at 15-5-10 analysis.3.Turf at 21-0-0 analysis.4.Trees at 32-7-7 analysis (Injecto-Feed).5.Trees at 0-4-4 analysis (Agri-Plex).2.2SOIL FERTILITY TESTA.The Contractor will be required to furnish the Owner with two (2) soil fertility reports includingcorrective recommendations.B.The exact location of each soil sample taken will be provided by the Architect or Owner.C.Soil fertility testing will be conducted by a laboratory specializing in this type of testing and approvedby the Architect or Owner.2.3MULCHA.Partially decomposed dark brown, fine shredded hardwood bark mulch.2.4WATERA.Water will be supplied by the Owner.2.5PLANT REPLACEMENTA.It will be the responsibility of the Landscape Maintenance Contractor to replace any and all plantmaterial that is dead or damaged due to non-performance of the contracted scope of work,un-supervised personnel or un-supervised subcontractors.2.6PESTICIDES AND HERBICIDESA.Pesticides and herbicides shall be of the type that is commercially available.PART 3 -EXECUTION3.1TREE, SHRUB AND GROUNDCOVER MAINTENANCEA.The Scope of Work for plant maintenance includes all possible means required to preserve the plantsand vegetative material existing within the site in a healthy and vigorous growing condition to insuretheir successful establishment. Plant maintenance shall include, as a minimum, the following items.1.Pruning: All trees and shrubs, within the limits of landscape maintenance, shall be prunedby the Contractor to the satisfaction of the Owner. Pruning shall be done in accordance withaccepted pruning practices as set forth by the National Arborist Association in PruningStandards for Shade Trees (current edition). Dead or damaged limbs on trees and shrubs,including sucker-growth on trunks of trees, are to be removed Crape Myrtles will be pruned inlate winter to remove seed heads and dead wood. Suckers will be removed as neededthroughout the year. All pruned materials shall become the property of the Contractor andshall be disposed of in a manner acceptable to the Owner. Unless directed differently in thecontract documents, pruning shall be accomplished once during the term of this contract.2.Insect, Disease, and Animal Control: The Contractor shall inspect the plants and plantedareas once each two (2) weeks or as approved by the Owner. The Contractor shall berequired to notify the Owner in writing of problems with insects, diseases, or animals as suchproblems arises. The Contractor also shall recommend corrective measures in writing.3.The Contractor shall treat the plants and/or the planted areas in accordance with acceptedmethods of horticultural practices and the Texas Department of Agriculture guidelinesregarding the use of pesticides. The Contractor also shall follow the manufacturer'sinstructions for the use and application of any pesticides.4.Bed Maintenance: The Contractor shall maintain the plant basins and beds free of weeds andgrass or other material detrimental to the growth of the plants or appearance at the site.Herbicides, when used by the Contractor, will under no circumstances be used on days wherethe wind could cause drift hazard to desirable plants. The Contractor shall also follow themanufacturer's instructions for the use and application of any herbicide. Two pre-emergentherbicide applications will be made per year along with manual weeding and post emergentherbicide applications as required. All shrub and groundcover beds shall be fertilized two (2)times per year at a rate of 2 lbs. Per 1,000 square feet. Hardwood mulch shall be maintainedto a minimum depth of two (2) inches, in all bed areas.5.Re-staking, re-guying, and re-bracing of Plants: Any damaged or destroyed stakes, guys orbraces shall be replaced by the Contractor. This shall include any adjustment to the stakingor guying to prevent girdling of plants. Adjustment will be made to tighten wires and cablesas required.6.Seasonal Color: All seasonal color beds will be changed three (3) times per year, spring,Summer and Fall. Each seasonal color change will include the following:a)Four inch pots spaced triangularly at 9 inches on center - plant species to be selectedby the Owner or Owner's Representative.b)Texas Color Blend fertilizer (19-13-6) applied at the recommended rate.c)Two inches of compost tilled into the existing soil.7.Tree Mulching and Fertilization:a)Maintain a 2” layer of shredded hardwood mulch over all tree root balls in turf areas.Add new mulch as required.b) Deep root fertilize all trees with a combination of Injecto-Feed 32-7-7 and Agri-Plex0-4-4 with 2 percent magnesium, 2 percent water soluble magnesium, 3 percentsulfur, .02 percent boron, 5 percent iron, .5 percent manganese and .5 percent zinc.Mix 20 pounds of Injecto-Feed and 1 gallon of Agri-Plex in 100 gallons of water. Applythis solution at the rate of 5 gallons per inch trunk diameter measured at breast height.Space injection points at 2.5 foot intervals starting 2 feet beyond the drip line. Apply .5gallon of solution per injection site. Soil injections should be made 6 to 8 inches deepusing an injector probe at 150 to 200 PSI. Keep fertilizer solution agitated duringapplication. Where trees are closely spaced and have overlapping treatment areas,inject only once in those areas. Do not double inject these areas. For trees growing inwells surrounded by concrete, water or other hard surfaces, drench the top of the rootball with 10 to 15 gallons of fertilizer solution.3.2TURF AND GRASS MAINTENANCEA.Bermuda Grass:1.Mowing and Trimming: All lawns shall be mowed approximately every seven days April thruSeptember, three (3) times per month in March and October and once monthly November thruFebruary. All sidewalks and curbs shall be edged, and trimming around all trees and otherobjects within turf areas shall occur in concurrence with the maximum mowing cycles. TheContractor shall use power equipment as approved by the Owner. Nylon cord trimmers shallnot be used inside plant basins or beds around plant material2.Fertilization: Bermuda grass shall be fertilized in March, May, July and September for a totalof four (4) applications. Approximately 1.5 to 2 lbs. nitrogen will be applied per 1,000 squarefeet per application. Various analyses and blends of fertilizers can be used based on soil testsresults.3.Weed Control: Bermuda grass shall be treated with two (2) pre-emergent herbicide and four(4) post-emergent herbicide applications for a total of six (6) applications. Herbicideapplications will only be required on established stands of grass.I.Technical Concentrate and Plant Enhancer: BioPlex @ 1-800-441-3573 Pre-Emergent Herbicide:Barracade or Pre-M.2.4MAINTENANCEG.Water will be provided by the Owner. Provide necessary hoses and other watering equipmentrequired to complete work.H.Until Final Acceptance, maintain plantings and trees by watering, cultivating, weeding, spraying,cleaning and replacing as necessary to keep the landscape in a vigorous, healthy condition andrake bed areas as required.I.Follow landscape maintenance procedures outlined in Specifications Section 329510 - PlantingMaintenance.PART 3 -EXECUTION3.1EXAMINATION AND PREPARATIONA.Examine sub-grade and other related construction for defects that adversely affect Work.B.Do not proceed until unsatisfactory conditions have been corrected.C.Plant trees and shrubs during normal seasons for such work in the project location and only whenweather conditions are suitable.D.Plant trees and shrubs after final grades are established and prior to planting of lawns.E.Additional soil amendments may be required per soil test results.3.2BED PREPARATIONA.When grassy or broadleaf weeds are present, spray with Roundup, a non-selective systemicherbicide, for 100% control. When Nut Sedge is present, spray with Manage, a selective postemergent herbicide, for 100% control. Application of post emergent herbicides is to be performedby a licensed applicator.B.Layout and stake beds for Architect's approval prior to installation of steel edging and planting.C.Excavate existing soil from beds as needed to allow for installation of the specified organiccompost and mulch. Excavated materials will be removed from the site as required by theArchitect and Owner.D.IMPORTANT: Provide 9 inches of composted organic material in shrub and groundcover beds.E.Till to a depth of 12 inches.F.Add commercial fertilizer at 7 pounds per 1,000 square feet of bed area and apply prior toapplication of mulch.A.The fertilizer type and rate specified herein is applicable unless countermanded by the soil fertilitytest corrective recommendations, in which case they will be applicable.G.Grade beds to allow for free flow of surface water to the bed edge and away from buildings. Bedswill be mounded 2 inches to 3 inches and tapered at the edges to meet existing grade.3.3SHRUB AND GROUNDCOVER SPACINGA.Place plants in position on bed areas before containers have been removed. Obtain approval fromArchitect. Do not remove burlap from shrubs.B.Plant where located, setting plants with tops of balls even with tops of beds, and compact soilcarefully around each plant ball.C.Remove binding materials (such as twine, nylon cord, and wire) from plant trunk.D.Water each plant thoroughly with hoses to eliminate air pockets.E.Carefully prune plants to remove dead or broken branches and hand-rake bed areas to smooth,uneven surfaces.F.Architect reserves the right to interchange or shift locations of plants prior to planting.G.Apply pre-emergent herbicide, at the recommended rate, three weeks after plant installation hasbeen completed and prior to mulch installation.3.4PLANTINGA.Ornamental Trees and Large Shrubs:1.Plant trees and shrubs in pits 3 times greater in diameter than root ball. Top 1/3 of backfillwill be 20% compost mixed with 80% native soil. Bottom 2/3 of backfill will be 100% nativesoil. Carefully settle by watering to prevent air pockets.2.Add fertilizer tablets at the rate of four (4) per 1 inch caliper for trees and four (4) per 24inches of height for large shrubs. Follow label directions for placement of tablets.3.Carefully prune trees to remove dead and broken branches.4.Place root ball in the center of the hole. Do not handle tree by the trunk to place in hole.Scarify and roughen sides of hole where glazed by mechanical excavation.5.Make sure the root flare is 2 inches higher than the adjacent soil elevation. The top of theterminal roots at the outer edge of the root ball should be even with or slightly higher than theadjacent soil elevation. Set root ball on undisturbed soil.B.Shade Trees:1.Plant trees in pits 3 times greater in diameter than root ball. Top 1/3 of backfill will be 20%compost mixed with 80% native soil. Bottom 2/3 of backfill will be 100% native soil.Carefully settle by watering to prevent air pockets.2.Add four (4) fertilizer tablets per caliper inch. Follow label directions for placement of tablets.3.Carefully prune trees to remove dead and broken branches.4.Place root ball in the center of the hole. Do not handle tree by the trunk to place in hole.Scarify and roughen sides hole where glazed by mechanical excavation.5.Make sure the root flare is 2 inches higher than the adjacent soil elevation. The top of theterminal roots at the outer edge of the root ball should be even with or slightly higher than theadjacent soil elevation. Set root ball on undisturbed soil.C.Shrubs Outside Of Beds:1.Plant shrubs in pits as sized below. Backfill mix will be 50% existing soil and 50% compost.Excess excavated material will be removed from the site as required by the LandscapeArchitect and Owner. Set root ball on undisturbed soil. Container Size Pit Size 1 Gallon 10” Diameter x 8” Depth 2 Gallon 14” Diameter x 10” Depth 3 Gallon 16” Diameter x 12” Depth 5 Gallon 20” Diameter x 14” Depth 7 Gallon 24” Diameter x 16” Depth2.Add fertilizer tablets at the rate of four (4) tablets per 24 inches of plant height. Place tabletsFollow label directions for placement of tablets.3.Carefully prune plants to remove dead and broken branches.3.5SUMMER DIGGING & TRANSPLANTINGA.To minimize transplant shock, plant decline, defoliation or loss to all balled and burlaped plants.1.Apply Technical Concentrate and Plant Enhancer to plants 24 to 96 hours prior to digging ortransplanting.2.Apply with both a foliar and root drench at identical dilutions of 1.0 fl. oz. (low stressconditions) to 3.0 fl. oz. (high stress conditions) per inch of trunk diameter or each 24 inchesof plant height. Mix into 5 to 10 gallons of water for each 1 inch of trunk diameter and 24inches of plant height.3.Re-apply in 15 to 30 days or sooner if extreme environmental stress requires Re-apply ateither a rate of 1 to 3 fl. oz. per inch of trunk diameter or 5 to 7 fl. oz. per 5 to 10 gallons ofwater.3.6TREE SUMPSA.Perform percolation test for each tree pit and install sump detail only when satisfactory drainagedoes not occur within 24 hours.B.Excavate sump pit to a minimum depth of 4 feet 6 inches below bottom of root ball and a minimumof 12 inch diameter.C.Install 4 inch diameter PVC pipe and cap. The portion of pipe in crushed rock is to be perforated.D.Place crushed rock per tree planting detail.E.Place filter fabric over top of crushed rock and 12 inches up side of tree pit.F.Paint PVC cap, color to be selected. Drill 5/8 inch diameter hole in top of cap.3.7GUYING TREESA.Guy trees immediately after planting as shown on planting details.B.All conifer and juniper variety of trees will be guyed per the tree planting detail.C.All container grown and containerized trees will be guyed per the tree planting detail.D.All balled and burlap trees are not required to be guyed but maybe guyed with the Architectsapproval.E.It will be the Landscape Contractor's responsibility to maintain trees in a plumb position through thewarranty period whether they are guyed or not.F.The landscape contractor will remove and dispose of tree guying materials at the end of the oneyear guarantee period.3.8MULCHINGA.After planting has been completed and approved by Architect, cover all bare soil around plants.The depth shall vary depending on the plants being mulched. Large plants will receive a 3 inchdepth and plants in 4 inch pots and smaller will receive a 1 inch depth. At no time will mulch comein contact with the stems of plants. Delay mulching in shrub beds until after application ofpre-emergent herbicide and near substantial completion of the project.3.9STEEL EDGINGA.Install steel edging. Anchor with steel stakes, 16 inches in length minimum, spaced not more than30 inches on center and driven at least 1 inch below top of edging. The top of edging will be 1 inchabove the adjacent elevation3.10CLEANUPA.During work, keep premises neat and orderly including organization of storage areas. Trash,including debris resulting from removing weeds or rocks from planting areas, preparing beds, orplanting plants, shall be removed from site daily as work progresses.B.Keep sidewalks, streets and courtyard areas clean by sweeping or hosing.3.11MAINTENANCEA.Water will be provided by the Owner. Provide necessary hoses and other watering equipmentrequired to complete work.B.Until Final Acceptance, maintain plantings and trees by watering, cultivating, weeding, spraying,cleaning and replacing as necessary to keep the landscape in a vigorous, healthy condition andrake bed areas as required.\C.Follow landscape maintenance procedures outlined in Specifications Section 329510 - PlantingMaintenance.3.12PLANT SCHEDULEA.Refer to schedule on drawings.A.Sod Second Application (Saint Augustine Only):5.15% nitrogen.6.5% phosphoric acid.7.10% potash.2.3HYDRO MULCH MATERIALSA.The hydro mulch shall be composed of virgin wood cellulose fiber and contain no germination orgrowth-inhibiting factors. It shall have a consistent texture which disperses evenly and remainssuspended in agitated water. It shall have a temporary green dye and the following property analysis:1.Moisture content: 9.0% 3% O.D. basis.2.Organic matter: 99.2% 0.8%3.Ash content: 0.8% 0.2%4.PH: 4.8% 0.5%.5.Water Holding Capacity (grams of H20 per 100 grams of fiber): 1150 minimum.B.Source: Weyerhauser, Conweb or equal.C.Hydro Mulching Additive (Binder): Ecology “Control-M-Binder” organic seeding additive or equal.2.4EROSION BLANKETA. Curlex Blanket manufactured by American Excelsior Company (817 640-2161) or equal.PART 3 -EXECUTION3.1GENERALA. Execute grass planting operations across slope and parallel to finished grade contours.3.2PRE-PLANT WEED CONTROLA.Irrigated and non-irrigated Grass Areas:1.If grassy or broadleaf weeds exist on site at the beginning of work, spray with a non-selectivesystemic contact herbicide, as recommended and applied by an approved licensed landscape pestcontrol advisor and applicator. Leave sprayed plants intact for at least 15 days to allow systemickill.2.Clear and remove these existing weeds by mowing or grubbing off all plant parts at least .25inches below the surface of the soil over the entire area to be planted.B.Irrigated Grass Areas Only:1.After irrigation system is operational, apply water for 5 to 10 days as needed to achieve weedgermination. Apply contact herbicides and wait as needed before planting. Repeat as needed.2.Maintain lawn and grass areas weed free until final acceptance by Owner utilizing mechanical andchemical treatment.3.3SOIL PREPARATIONA.Tillage:1.Tillage shall be accomplished to loosen all areas of compacted soil. When placement of topsoil isspecified, till compacted areas prior to placement.2.Till with heavy duty disc, rototiller, or chisel-type breaking plow, chisels set not more than 10inches apart. Till to a depth of 1 to 3 inches.3.Initial tillage shall be done in crossing pattern for double coverage then followed by a disc harrow.B.Cleaning:1.Remove debris, building materials, rubbish, weeds, and stones larger than 1 inch in diameter.2.Use Rock Pick or other machinery to gather surface stones larger than 1 inch in diameter.C.Fine Grading:1.After tillage and placement of topsoil, level, fine grade, and drag with a weighted spike harrow orfloat drag. Eliminate ruts, depressions, humps and objectionable soil clods.3.4FERTILIZINGA.A. The fertilizer types and rates specified herein are applicable unless countermanded by the soilfertility test corrective recommendations, in which case they will be applicable.B.Bermuda Grass Seeding, Annual Rye Grass Seeding, Weeping Love Grass Seeding and Hydro Mulching:1.Initial Application: Apply at installation at a rate of 18 pounds per 1,000 square feet. Whenseeding, incorporate into soil with a chain harrow. When hydro mulching, incorporate into theslurry.2.Second Application: Apply 45 days after germination at a rate of 10 pounds per 1,000 square feet.C.Buffalo Grass Seeding:1.Initial Application: Apply 45 days after germination at a rate of 15 pounds per1,000 square feet.2.Second Application: Apply 90 days after germination at a rate of 15 pounds per 1,000 square feet.D.Bermuda / Zoysia grass Sprigging and Sodding:1.Initial Application: Apply no more than 5 days prior to commencement of sprigging or soddingoperations at a rate of 20 pounds per 1,000 square feet. Incorporate into soil with a chain harrow.2.Second and Third Applications: Apply every 25 days after sprigging or sodding at a rate of 10pounds per 1,000 square feet.3.Irrigate the area with a minimum of .25 inches of water to properly incorporate the fertilizer into theturf.E.Saint Augustine Sodding:1.Initial Application: After the first mowing apply at 5.5 pounds per 1,000 square feet.2.Second Application: Apply at 7 pounds per 1,000 square feet approximately 45 days after initialapplication, if during growing season.3.5PLANTING SODA.Weather Conditions:1.Schedule work for periods of favorable weather.2.Sod placement on days which, in the judgment of the Landscape Architect, are too hot, cold,sunny, dry or windy for optimal installation may be prohibited.B.Placement Pattern:1.The first row shall be laid in a straight line with subsequent rows parallel to the first row and tightlyabutting each other.2.Lateral joints shall be staggered. Care shall be exercised to insure that the sod is neither stretchednor overlapped. Joints must be butted tightly to prevent voids that could permit air to dry outroot.3.Immediately after placing, sod shall be pressed firmly into contact with bed by tamping or rolling toeliminate air pockets. Following tamping, screened topsoil shall be used to fill all cracks andexcess soil shall be worked into the sod with rakes or other suitable equipment. Sod shall not besmothered with excess fill soil.4.On slopes steeper than 3 to 1, sod shall be secured by galvanized pins, wood pegs or othermethods approved by the Landscape Architect.5.Immediately after sodding operations have been completed, the entire surface shall be compactedwith a roller or other approved equipment. The completed area after sodding shall be uniformlyeven, firm and true to finished grade lines.C.Watering:1.Initial Installation: Water must be applied within 2 hours of exposure of the sod to sun or wind.Water newly laid sod until saturation of the entire area is apparent. As a result of initial irrigation,standing water may be present and moderate to heavy run off may occur. Continue to irrigate on adaily basis in shorter durations so the entire area stays thoroughly wet but without standing water.The length of irrigation time and frequency of applications will vary at different locations due toweather conditions and individual site characteristics.2.After 7 to 10 days: Check for new root growth by lifting corners of sod blocks. If consistent rootgrowth over the entire site is observed, water applications can be reduced to once every other day.3.After 12 to 14 days: Recheck for additional rooting. If sod blocks are difficult to pull up oradditional new roots are present allow the area to dry to the extent that mowing can be performed.3.6GRASS CONVERSIONA.Conversion of temporary grass to permanent grass:1.Spray temporary grass with an approved herbicide - 95% kill rate minimum.2.Scalp dead grass with mowing equipment.3.Lightly scarify soil surface using a verticut machine or like equipment.4.Apply permanent grass seed as specified.3.7GRADINGA.Maintain existing established grades, protect true and even during operations.3.8EROSION CONTROLA.During work and maintenance period, maintain topsoil in place at established grades. Replace topsoiland turfgrass losses due to erosion.3.9CLEAN-UPA.Remove excess material and debris from site.3.10MAINTENANCEA.Until Final Acceptance, maintain lawn and grass areas by watering, mowing, weeding, spraying, cleaningand replacing as necessary to keep the turf and grass in a vigorous, healthy condition.1.Watering: As necessary. Provide temporary above ground sprinklers over un-irrigated areasincluding temporary water meter if required. Water cost will be paid separately by the Owner orGeneral Contractor unless noted differently on the drawings or bid form.2.Mowing:a)Bermuda Grass Sod, Hydro mulch & Sprigging: Mow newly planted grass areas weekly afterinitial growth reaches 1.5 to 2 inches.b)Annual Rye Grass: Mow newly planted grass areas after initial growth reaches 2 to 3 inches.Additional mowings may be required as directed by the Owner and Architect.c)Saint Augustine Sod: Mow newly planted grass areas weekly at a height of 2 to 3 inchesafter initial growth reaches 3 inches.3.Weeding: Remove weeds and foreign grass over lawn and grass areas at least once a week.Herbicides may be used only when approved by the Owner and Architect.4.Follow landscape maintenance procedures outlined in specification section 329510 - LandscapeMaintenance.TURF AND GRASSES (CONT.)LANDSCAPE MAINTENANCE (CONT.)TURF AND GRASSESPART 1 -GENERAL1.1SECTION INCLUDESA.Furnish all labor, material, equipment related services and supervision necessary for or incidental tothe installation of the lawns and grasses as shown or indicated on the Drawings and/or asspecified.B. Work Included:1.Soil Preparation and Fine Grading.2.Fertilization.3.Grass Seeding4.Grass Hydro Mulch.4. Insect, Disease and Animal Control: The Contractor shall inspect all lawn areas onceeach two (2) weeks or as approved by the Owner. The Contractor shall be required tonotify the Owner in writing of problems with insects, diseases, or animals as suchproblems arises. The Contractor also shall recommend corrective measures in writing.3.3IRRIGATION SYSTEM OPERATION AND MAINTENANCEA.The scope of work for the operation and maintenance of the permanent irrigation system shallconsist of the monitoring, adjustment, repair and proper operation of the existing irrigation systemas required insuring adequate moisture to the plant material existing on the project. The existingcondition of the system and any known deficiencies will be corrected by the Contractor uponapproval by the Owner. The Contractor shall insure that all irrigation zones, rain sensors andfreeze sensors are operating correctly. Include seasonal draining and winterizing of irrigationsystem when required.B.System repairs will include monitoring of the system on a year round bi-weekly basis andreporting of all damaged or trouble areas to the Owner. The Contractors personnel shall repairany damage that may have occurred during the mowing cycle and set automatic systems tocorrect time requirements. Any damage not the fault of the Landscape Maintenance Contractorshall be assessed and brought to the attention of the Owner with an estimate of the subsequentcosts to make the repairs. In the event the irrigation system fails due to the Contractor's actionsor neglect, the Contractor shall furnish plant irrigation by a method and quantity approved by theOwner.PART 1 - GENERAL1.1RELATED DOCUMENTSA.Provisions established in the “Uniform General Conditions for Construction Contracts”, Construction Agreementbetween Owner and Contractor, Division 1 - General Requirements, and the Drawings are collectively applicableto this Section.1.2SECTION INCLUDES:A.Furnish all labor, material, equipment, related services and supervision necessary or incidental to the installationof all gravel paving, of various types, as shown or indicated on the Drawings and/or as specified.1.3RELATED DOCUMENTS:A.Drawings and General provisions of the Contract, including General and Supplementary Conditions and Division 1Specification Sections, apply to this Section.B.All other Divisions of the Contract Documents. Refer to each Division's specifications and drawings for allrequirements, including but not limited to the following:1.Fine Grading - Section 312216.2.Planting - Section 329310.1.4REFERENCE STANDARDS:A.ANSI/ASTM D698 - Moisture-Density Relations of Soils and Soil-Aggregate Mixture Using 5.5 lbs Rammer and12-inch Drop.1.5SUBMITTALS:A.Gravel: Submit 5 pound representative samples, for each gravel type, for color and gradation approval by theArchitect.B.Steel Edging: Submit complete manufacturer's descriptive literature and performance characteristics.C.Filter Fabric: Submit complete manufacturer's descriptive literature and performance characteristics.PART 2 - PRODUCTS2.1MATERIALS: (Sample Data)A.Crushed Rock: Ref. Material Legend (Sheet L1.01)B.Steel Edging: Ref. Material Legend (Sheet L1.01) (as manufactured by Ryerson Steel Company or approvedequal.)C.Filter Fabric: Water pervious type, black color, equal to Mirafi 600X by Mirafi, Inc. or Terra Tex H.D. by Web TecCorporation.D.Herbicide: Equal to Round-up by Monsanto.PART 3 - EXECUTION3.1EXAMINATION:A.Verify rough grades are properly prepared. Check compaction, slope and elevations prior to beginning work.Review policies established concerning protection of tree roots.3.2PREPARATION:A.Apply liquid herbicide at application rates as recommended by manufacturer. Allow foliage and grasses tocompletely die before continuing work.B.Excavate to subgrade required and re-compact to 95% of ASTM-D698.C.Install steel edging to form limits of paving. Stake and secure edging firmly to provide finish lines representingsmooth curves without irregularity. Set edge of surface flush with top edge of steel.3.3PLACEMENT OF PAVING:A.Install filter fabric in bottom of excavation to limits of steel edging and overlap edges a minimum of 6 inches.B.Compact all gravel with hand tampers or sod rollers as required to properly consolidate.3.4MAINTENANCE:A.Maintain throughout the duration of the project and on a regular basis to the satisfaction of the Owner andArchitect, all gravel surfaces, correcting grades, compaction and any areas damaged by construction or erosion.3.5CLEAN UP:A.Remove trash, debris and excess material from the site on a regular basis and as directed by the Architect.B.At the close of construction, leave surfaces in a clean, swept, condition.END OF SECTION321513 DECORATIVE ROCKBY DATE REVISIONSNo.DATESHEET NUMBERCHECKED BY: SCALE: DESIGNED BY: DRAWN BY: KHA PROJECT 6/24/2026 PHONE: 972-770-1300 FAX: 972-239-3820 WWW.KIMLEY-HORN.COM TX F-928 © 2026 KIMLEY-HORN AND ASSOCIATES, INC. LAST SAVED 6/24/2026 10:53 AMPLOTTED BY BRIM, JESSE 6/24/2026 10:54 AMDWG PATH C:\ACC\ACCDocs\Kimley-Horn\067545015_TRADEMARK SOUTHLAKE\Project Files\CAD\Private Single Family\PlanSheetsDWG NAME L-Landscape Plan.dwg , [ L-03 ]IMAGESXREFS xTree : xSurvey : xHard : xPlant : xSite-SF : xStrm-SF : xUtil-SF : xBase-PC : xDryUtility-PC : xStrm-PC : xUtil-PC : xBase-GI : xStrm-GI : xUtil-GI : xArch-MI : xBase-MI : xArch-PC : xEsmt-MI : xUtil-MI : x22X34-PSF : Gate Details : xGrad-SF 13455 NOEL ROAD, TWO GALLERIA OFFICE TOWER, SUITE 700, DALLAS, TX 75240 AS NOTED ERG AGB CMDCITY OF SOUTHLAKE, TEXAS SHIVERS' FARM PRIVATE SINGLE FAMILY 067545015 PDF PDF JSB 06.29.2026FOR REVIEW ONLYNot for construction or permit purposesP.L.A.L.A. No.DatePaul D. Freeland245806/29/26 HARDSCAPE SPECIFICATIONSL-04SPECIFICATIONS:PART 1 -GENERAL1.1SECTION INCLUDESA.Furnish all labor, material, equipment, related services and supervision necessary for or incidental to theinstallation of the cast_in_place pedestrian concrete as shown or indicated on the drawings and/or as specified.1.2REFERENCE STANDARDSA.The work described in this Section, unless otherwise noted on the Drawings, or herein specified, shall begoverned by the latest editions of the following codes or specifications.B.American Concrete Institute (ACI):1.ACI 211.1-81 “Recommended Practice for Selecting Proportions of Normal Weight Concrete.”2.ACI 304, “Recommended Practice for Measuring, Mixing, Transporting and Placing Concrete.”3.ACI 305, “Hot Weather Concreting.”4.ACI 306, “Cold Weather Concreting.”5.ACI 308, “Standard Practice for Curing Concrete.”6.ACI 309, “Standard Practice for Consolidation of Concrete.”7.ACI 311, “ACI Manual of Concrete Inspection.”8.ACI 318, “Building Code Requirements for Reinforced Concrete.”C.American Society for Testing and Materials (ASTM):1.ASTM C31, Method of Making and Curing Concrete Test Specimens in the Field.2.ASTM C33, Standard Specification for Concrete Aggregate.3.ASTM C39, Test Method for Compressive Strength of Cylindrical Concrete Specimens.4.ASTM C94, Standard Specification for Ready-Mix Concrete.5.ASTM C136, Standard Method for Sieve Analysis of Fine and Coarse Aggregates.6.ASTM C150, Standard Specification for Portland Cement.7.ASTM C260, Standard Specification for Air-Entraining Admixtures.8.ASTM C494, Standard Specification for Chemical Admixtures for Concrete.9.ASTM C595, Standard Specification for Blended Hydraulic Cements.1.3SUBMITTALS:A.Mix Designs: The Contractor shall submit proposed mix designs, including confirmation cylinder test results, inaccordance with ACI 318 to the Testing Laboratory for evaluation a minimum of 14 days prior to placingconcrete.B.No fly ash will be allowed in exposed pedestrian paving.C.Show:1.Proportions of cement, fine and coarse aggregates, and water2.Combine aggregate gradation3.Aggregate specific gravities and gradations4.Water-cement ratio, design strength, slump and air content5.Type of cement and aggregates6.Type and dosage of admixtures7.Type, color and dosage of integral coloring compounds, where applicable8.Special requirements for pumping9.Range of ambient temperature and humidity for which design is valid10.Any special characteristics of mix which require precautions in mixing, placing, or finishing techniquesto achieve finished product1.4FIELD SAMPLESA.Cast a 4'x4' field sample, in form work, of each type and finish as specified on the drawings.B.Use specified concrete.C.Show each color, joint pattern and profile, and surface finish.D.Obtain acceptance of surface finish from Architect.E.Maintain approved mockup panel exposed to view for duration of concrete work it will be used as basis forcomparison of remainder of Work; leave in place and protect from damage until removal is authorized byArchitect.F.Remove when directed.1.5QUALITY ASSURANCEA.Source Quality Control: Concrete production facilities shall meet the requirement for certification by theNational Ready Mixed Concrete Association.B.Concrete Mix Design Criteria1.Design Concrete mixes in accordance with ACI 318.2.For each concrete mix type proposed, make trial mix using aggregate proposed.3.Determination of required average strength above specified strength shall be in accordance with ACI318.4.Make advance tests of trial mixes with proposed materials. Mold and cure test cylinders in accordancewith ASTM C39. Do not place concrete on project until laboratory reports and results of confirmationcylinder tests have been evaluated by the Testing Laboratory and results indicated that proposed mixeswill develop required strengths.5.Check mix designs and revise if necessary wherever changes are made in aggregates or in surfacewater content of aggregate or workability of concrete. Slump shall be a minimum to produce workablemix. Laboratory shall prescribe maximum quantity of water.6.Testing Laboratory shall furnish the Architect with a written evaluation of each proposed concrete mixdesign submitted by the Contractor.1.6DELIVERY, STORAGE AND HANDLINGA.Deliver packaged products to site in manufacturer's sealed and labeled containers; inspect to verify compliancewith specified requirements.B.Label containers to indicate manufacturer's name, product name, date of manufacture, and instructions for use.C.Store liquid materials in tightly covered containers in well ventilated area at ambient temperaturesrecommended by manufacturer. Store dry materials on raised platforms and cover to prevent moisturedamage. Maintain containers in clean condition, free of foreign materials and residue with labels in legiblecondition.D.Mix and deliver concrete to project ready_mixed in accordance with ASTM C 94. Mix concrete a minimum of70 revolutions of transit mix drum at mixing speed. A minimum of 40 revolutions shall be at the productionplant.1.Schedule delivery so that continuity of any pour will not be interrupted for over 15 minutes.2.Place concrete on site within 90 minutes after proportioning materials at batch plant.1.7TESTSA.Testing firm will take cylinders and perform slump and air entrainment tests in accordancewith ACI 301.B.Four concrete test cylinders will be taken for every 50 or less cubic yards of each class ofconcrete placed each day.C.One slump test will be taken for each set of test cylinders taken.D.Provide free access to the work and cooperate fully with appointed testing laboratory.E.Test for air entrainment on all concrete exposed to freeze_thaw cycle.1.8COORDINATIONA.Coordinate Work of this Section with work of other Sections as required to properly executethe Work and as necessary to maintain satisfactory progress of the work of other Sections.1.9ENVIRONMENTAL REQUIREMENTSA.Do not place concrete when base surface or ambient temperature is less than 40 degrees For if base surface is wet or frozen.B.Maintain ambient temperature during curing period above 70 degrees F for 3 days or above50 degrees F for 5 days.C.Protect from rain or running water.PART 2 -PRODUCTS2.1CONCRETE MATERIALSA.Cement: ASTM C150, Normal _ Type II; gray color. No fly ash permitted for any slabs ongrade.B.Fine Aggregate: ASTM C33, clean, hard, durable, natural sand free from silt, loam or clay.C.Coarse Aggregate: 3/8” WHITE LIMESTONE - REF. MATERIAL LEGEND.D.Grading shall be in accordance with “Standard Method for Sieve Analysis of Sieve andCoarse Aggregates” (ASTM C136).E.Water: ASTM C94, Paragraph 4.1.3; potable, clean and free from oil, acid and injuriousamount of vegetable matter, alkalis, and other impuritiesF.Air-Entraining Admixture: ASTM C-260G.Water Reducing Admixture: ASTM C-494, Type A or D.H.Forms: Nominal 2 inch thickness Southern Pine or steel paving forms.I.Joint Fillers: ASTM DM52 Type I, non-asphaltic or construction heart grade redwood, soundand free of checks, splits or other defects with pull stripJ. IMPORTANT - For all sandblasted concrete flatwork, contractor to substitute 3/8” washedcrushed limestone for aggregate for all Course Aggregate as specified above. Any deviationwill require Owner approval prior to installation.CONCRETE PAVING JOINTS AND SEALANTSPART 1 -GENERAL1.1SECTION INCLUDESA.Furnish all labor, material, equipment, related services and supervision necessaryfor or incidental to the performance of all sealant work as shown or indicated onthe Drawings and/or specified.B.Required applications of sealants include, but are not necessarily limited to thefollowing general locations:1.Expansion and contraction joints within Portland cement concrete pavement.1.2SUBMITTALSA.Product Data: For each joint-sealant product indicated.B.Color Charts: Submit charts of available colors for each type of sealant for review,final color selections to be made by Architect.C.Product Certificates: Signed by manufacturers of joint sealants certifying thatproducts furnished comply with requirements and are suitable for the useindicated.D.Qualification Data: For firms and persons specified in “Quality Assurance” Articleto demonstrate capabilities and experience. Include lists of completed projectswith project names and addresses, names and addresses of architects andowners, and other information specified.1.3QUALITY ASSURANCEA.Manufacturers: Obtain each type of joint sealant through one source from a singlemanufacturer.1.Testing will not be required if joint sealant manufacturer submits jointpreparation data that are based on previous testing of current sealantproducts for adhesion to, and compatibility with, joint substrates and othermaterials matching those submitted.B.Installer: An experienced installer who has specialized in installing joint sealantssimilar in material, design and extent to those indicated for this Project and whosework has resulted in joint sealant installations with a record of successfulin-service performance.1.4JOB CONDITIONSA.Environmental Limitations: Do not proceed with installation of joint sealants underthe following conditions:1.When ambient and substrate temperature conditions are outside limitspermitted by joint sealant manufacturer.2.When joint substrates are wet.B.Joint-Width Conditions: Do not proceed with installation of joint sealants wherejoint widths are less than that allowed by joint sealant manufacturer for applicationindicated.C.Joint-Substrate Conditions: Do not proceed with installation of joint sealants untilcontaminants capable of interfering with their adhesion are removed from jointsubstrates.1.5DELIVERY, STORAGE AND HANDLINGA.Deliver materials to Project site in original unopened containers or bundles withlabels indicating manufacturer, product name and designation, color, expirationdate, pot life, curing time and mixing instructions for multicomponent materials.B.Store and handle materials to comply with manufacturer's written instructions toprevent their deterioration or damage due to moisture, high or low temperatures,contaminants or other causes.PART 2 -PRODUCTS2.1MATERIALS, GENERALA.Compatibility: Provide joint sealants, backing materials and other related materialsthat are compatible with one another and with joint substrates under conditions ofservice and application as demonstrated by joint sealant manufacturer based ontesting and field experience.B.Colors of Exposed Joint Sealants: To match adjacent concrete color. Final colorselection to be made by Architect.2.2COLD-APPLIED JOINT SEALANTSA.Type NS Silicone Sealant for Concrete (02 764A): Single-component, low modulus,neutral-curing, nonsag silicone sealant complying with ASTM D 5893 for Type NS.B.Type SL Silicone Sealant for Concrete and Asphalt (02 764B): Single component,low modulus, neutral-curing, self-leveling silicone sealant complying with ASTM D5893 for Type SL.C.Available Products: Subject to compliance with requirements, cold-applied jointsealants that may be incorporated into the Work include, but are not limited to, thefollowing:1.Type NES Silicone Sealant for Concrete (02 764A):a.Roadsaver Silicone-SL; Crafco Inc.b.888; Dow Corning.2.Type SL Silicone Sealant for Concrete and Asphalt (02 764B):c.890-SL; Dow Corning.2.3JOINT-SEALANT BACKER MATERIALSA.General: Provide joint-sealant backer materials that are non-staining; arecompatible with joint substrates, sealants, primers and other joint fillers; and areapproved for applications indicated by joint sealant manufacturer based on fieldexperience and laboratory testing.B.Round Backer Rod for Cold- and Hot-Applied Sealants: ASTM D 5249, Type 1, ofdiameter and density required to control sealant depths and prevent bottom-sideadhesion of sealant.2.4PRIMERSA.Primers: Product recommended by joint sealant manufacturer where required foradhesion of sealant to joint substrates indicated, as determined frompreconstruction joint-sealant-substrate tests and field tests.PART 3 -EXECUTION3.1EXAMINATIONA.Examine joints indicated to receive joint sealants, with Installer present, forcompliance with requirements for joint configuration, Installation tolerances, andother conditions affecting joint-sealant performance.3.2PREPARATIONA.Surface Cleaning of Joints: Clean out joints immediately before installing jointsealants to comply with joint sealant manufacturer's written instructions.B.Joint Priming: Prime joint substrates where indicated or where recommended inwriting by joint sealant manufacturer, based on preconstructionjoint-sealant-substrate tests or prior experience. Apply primer to comply with jointsealant manufacturer's written instructions. Confine primers to areas ofjoint-sealant bond; do not allow spillage or migration onto adjoining surfaces.CONCRETE PAVINGCONCRETE PAVING (CONT.)2.2ADMIXTURESA.Acceptable Manufacturers: Subject to compliance with requirements herein,provide products from one of the following:1.W.R. Grace.2.Master Builders.3.SikaB.Calcium chloride, thiocyanates, or admixtures containing more than 0.05 percentchloride ions are not permitted unless approved by Architect.C.Air Entrainment: ASTM C 260D.Chemical Admixtures: ASTM C 494,1.Type A _ water reducing.2.3CONCRETE MIXA.Mix concrete in accordance with ASTM C 94, Alternative No. 2, or ACI 304.B.Design concrete to yield following characteristics unless otherwise indicated. MINIMUM 28 DAY COMPRESSIVE STRENGTH SLUMP USES 3500 PSI 4 to 6 Inches Slabs on Grade Sidewalks 4000 PSI 5 to 7 Inches Architectural concrete wallsC.Deliver concrete in accordance with ASTM C 94.D.Select proportions for normal weight concrete in accordance with ACI 301Method 1. Mix not less than one minute after materials are in mixer.E.Do not transport or use concrete after the following time has expired from time ofinitial mixing:1.90 minutes - when ambient temperatures are below 80 degrees F.2.75 minutes - when ambient temperatures are between 80 and 90 degrees F.3.60 minutes - when ambient temperatures are over 90 degrees F.F.Verify supplier of transit_mixed concrete has a plant of sufficient capacity, andadequate transportation facilities to assure continuous delivery at required rate.Frequency of deliveries to project site shall be such as to provide for continuousconcrete placement throughout any one pour.G.Use accelerating admixtures in cold weather and retarding admixtures in hotweather only when approved by Architect and testing laboratory. Use ofadmixtures will not relax cold weather placement requirements.H.Add air entraining agent to concrete mix for concrete work exposed to exterior, inamounts of 4-7% of total concrete volume or as otherwise recommended bytesting laboratory.I.Use of calcium chloride is strictly prohibited.J.Maintain water-cement ratio to produce a minimum of 3 to maximum of 5 inchslump.K.Refer to the site Geotech report for concrete requirements specific to site paving2.4CURING MATERIALSA.Acceptable Manufacturers: Subject to compliance with requirements indicated,provide products of one of the following:1.Sonneborn Building Products2.L & M Construction Chemicals3.Secure, Inc.4.Dayton Superior5.BurkeB.Sheet Curing Material: coated burlap sheeting, or regular waterproof paper.C.Water-Based Acrylic Membrane Curing Compound: ASTM C 309, Type I, ClassB; minimum 18 percent solids by volume.PART 3 -EXECUTION3.1EXAMINATIONA.Verify forms, anchors, seats, plates, reinforcement, joint materials, and otheritems to be cast into concrete are accurately placed, held securely, and will notcause hardship in placing concrete.B.Inspect masonry work used as forms. Do not proceed until masonry is completeand properly cured so as to withstand pressures of wet concrete.C.Correct unsatisfactory work prior to placing concrete.D.Remove rubbish from formwork immediately prior to placing concrete.E.Remove ice and excess water from excavations and formwork.F.Verify compacted sub-grade is ready to support paving and imposed loads, freeof frost, smooth and properly compacted.G.Verify gradients and elevations of base are correct and proper drainage has beenprovided so that water does not stand in the area to receive paving.H.Beginning of installation means acceptance of existing conditions.3.2PREPARATIONA.At locations where new concrete is doweled to existing work, drill over_sizedholes in existing concrete, insert steel dowels, and pack solid with non_shrinkgrout.B.If no vapor retarding membrane is placed, moisten base to minimize absorptionof water from fresh concrete.C.Refer to the site Geotech report for concrete requirements specific to sitepaving3.3JOINTSA.Intentional stoppage of concrete placing shall be at planned location of either anexpansion joint or contraction joint.B.When stoppage occurs at an expansion joint, install joint assembly with abulkhead of sufficient section drilled to accommodate required dowels.C.Expansion joints and fillers placed where shown on Drawings and as hereinspecified but not less than 30' apart, where walks or slabs abut curbs, building orother structures.D.When stoppage occurs at a contraction joint, install sheet metal joint assembly ofsufficient section to prevent deflection, shaped to concrete section. Drill bulkheadto permit continuation of longitudinal reinforcing steel through construction joint.E.Stoppage at Unintentional Location:1.Immediately upon unintended stoppage of concrete placing, place availableconcrete to a line and install bulkhead perpendicular to surface of pavementand at required elevation. Place and finish concrete to this bulkhead.Remove and dispose of concrete remaining on sub-grade ahead ofbulkhead.2.When placing of concrete is resumed before concrete has set to extent thatconcrete will stand on removal of bulkhead, new concrete shall be roddedwith the first; otherwise, carefully preserve joint face.3.Provide a joint seal space at edges created by a construction joint of thistype shall have a joint seal space as detailed on Drawings.F.Provide sawed contraction joints as detailed on Drawings, but in no case greaterthan 20'-0” o.c.1.Saw joints after completion of finishing operations as soon as concrete hashardened to extent necessary to prevent revealing of joint or damage toadjacent concrete surfaces.2.Saw joints same day that concrete is placed except that sawing of joints inconcrete placed late in day may be delayed until morning of following day.3.In any event, saw joints within 18 hours after placing concrete.4.Use a power-driven concrete saw made especially for sawing concrete andmaintain in good operating condition.5.Saw blades shall make a clean, smooth cut, producing a groove 1/8” to3/16” wide and a depth equal to one quarter of slab thickness, minimum 1inch depth.CONCRETE PAVING JOINTS AND SEALANTS (CONT.)3.3INSTALLATION OF JOINT SEALANTSA.General: Comply with joint sealant manufacturer's written installation instructionsapplicable to products and applications indicated, unless more stringentrequirements apply.B.Sealant Installation Standard: Comply with recommendations of ASTM C 1193 foruse of joint sealants as applicable to materials, applications and conditionsindicated.C.Install backer materials of type indicated to support sealants during application andat position required to produce cross-sectional shapes and depths of installedsealants relative to joint widths that allow optimum sealant movement capability.1.Do not leave gaps between ends of backer materials.2.Do not stretch, twist, puncture or tear backer materials.3.Remove absorbent backer materials that have become wet before sealantapplication and replace them with dry materials.D.Install sealants by proven techniques to comply with the following and at the sametime backings are installed.1.Place sealants so they directly contact and fully wet joint substrates.2.Completely fill recesses provided for each joint configuration.3.Produce uniform, cross-sectional shapes and depths relative to joint widthsthat allow optimum sealant movement capability.E.Tooling of Nonsag Sealants: Immediately after sealant application and beforeskinning or curing begins, tool sealants according to requirements specified belowto form smooth, uniform beads of configuration indicated, to eliminate air pockets;and to ensure contact and adhesion of sealant with sides of joint.1.Remove excess sealants from surfaces adjacent to joint.2.Use tooling agents that are approved in writing by joint sealant, manufacturerand that do not discolor sealants or adjacent surfaces.F.Provide joint configuration to comply with joint sealant manufacturer's writteninstructions, unless otherwise indicated.G.Provide recessed joint configuration for silicone sealants of recess depth and atlocations indicated.3.4CLEANINGA.Clean of Excess sealants or sealant smears adjacent to joints as the Workprogresses by methods and with clearing materials approved by manufacturersjoint sealants and of productions occur.3.5PROTECTIONB.Protect joint sealants during and after curing period from contact withcontaminating substances and from damage resulting from constructionoperations or other causes so sealants are without deterioration or damage at timeof Substantial Completion. If, despite such protection, damage or deteriorationoccurs, cut out and remove damaged or deteriorated joint sealants immediately soinstallations with repaired areas are indistinguishable from the original work.CONCRETE PAVING (CONT.)3.4PLACING CONCRETEA.Place concrete according to ACI 301 and 304R, except as modified andsupplemented on Drawings or in this Section.B.Notify Architect and Contractor's testing laboratory minimum of 48 hours prior tocommencement of placing operations.C.Cold weather concreting:1.Comply with requirements of ACI 301 and 306.2.Do not place concrete when ambient air temperature is expected to fall below40 degrees F within 24 hours, except with prior written approval of Architect.3.Remove frost, ice, and snow from formwork, reinforcing, and accessoriesprior to placing concrete.4.Do not place concrete foundations, footings or slabs on frozen ground.5.Limit concrete temperature at time of discharge to 55 degrees F for sectionsless than 12 inches in any dimension and to 50 degrees F for other sections.D.Hot weather concreting:1.Comply with requirements of ACI 301 and 305 when ambient air temperatureexceeds 75 degrees F.2.Use water-reducing, retarding admixture when required by hightemperatures, low humidity, or other adverse placing conditions to extendsetting time to limits specified as approved by Architect.3.Cool aggregates, cool mixing water, substitute ice for part of mixing water, ortake other measures to limit concrete temperature at time of discharge to 90degrees F.4.Cover reinforcing steel and steel forms with water soaked burlap or use fogspray to limit temperature of steel to 120 degrees F immediately prior toconcrete placement.E.At time of placement, provide concrete temperature between 50 degrees F and 90degrees F.F.Maintain surfaces receiving concrete at approximately same temperature asconcrete being placed.G.Maintain surface of hardened concrete below 100 degrees F.H.Convey concrete from mixer to place of deposit by method that will preventsegregation or loss of material, and that will not require addition of water toproduce desired slump at point of placement. Do not use supported reinforcing asrunway base for concrete conveying equipment.I.Depositing:1.Deposit concrete as nearly as practicable to its final location.2.Place concrete continuously between construction joints.3.Avoid inclined layers.4.Place each layer while preceding layer is still plastic.5.Do not allow free fall of concrete to exceed 4 feet.6.Place concrete without displacing reinforcing and accessories.J.Placing Concrete Paving:1.Deposit and consolidate concrete slabs in continuous operation, in singlelayer, within limits of construction joints, until placing of panel or section iscompleted.2.Bring slab surfaces to correct level with straightedge and strike-off.3.Use bull floats, highway straight edges, or darbies to produce smoothsurface, free of humps or hollows before bleed water appears on surface.4.Do not disturb slab surfaces prior to beginning finishing operations.3.5FINISHINGA.General: Provide finishes at locations specified on Drawings.B.Sandblast Finish: Refer to Sandblasting specificationC.Finishes for Related Unformed Surfaces: At tops of walls, horizontal offsets, andsimilar unformed surfaces, strike-off smooth and finish with texture matchingadjacent formed surfaces.3.6CURINGA.General:1.Comply with ACI-301, except as modified or supplemented.2.Start immediately after placing and finishing concrete.3.Protect from premature drying, temperature extremes, temperature variations,rain, flowing water, and mechanical injury.4.Cure continuously, without allowing to dry, for minimum period required forhydration of cement and hardening of concrete.5.Maintain temperature of concrete above 50 degrees F for curing period.3.7PATCHING AND REPAIRINGA.General:1.Patching will not be permitted without prior approval from Architect.3.8PROTECTIONA.Immediately after placement and continuing for 14 days, protect concrete frompremature drying, excessively hot or cold temperatures, rain or running water andmechanical injury.B.Maintain concrete with minimal moisture loss at relatively constant temperature forperiod necessary for hydration of cement and hardening of concrete.C.Provide raised runways for traffic areas.D.Protect concrete from staining.BY DATE REVISIONSNo.DATESHEET NUMBERCHECKED BY: SCALE: DESIGNED BY: DRAWN BY: KHA PROJECT 6/24/2026 PHONE: 972-770-1300 FAX: 972-239-3820 WWW.KIMLEY-HORN.COM TX F-928 © 2026 KIMLEY-HORN AND ASSOCIATES, INC. LAST SAVED 6/24/2026 10:53 AMPLOTTED BY BRIM, JESSE 6/24/2026 10:55 AMDWG PATH C:\ACC\ACCDocs\Kimley-Horn\067545015_TRADEMARK SOUTHLAKE\Project Files\CAD\Private Single Family\PlanSheetsDWG NAME L-Landscape Plan.dwg , [ L-04 ]IMAGESXREFS xTree : xSurvey : xHard : xPlant : xSite-SF : xStrm-SF : xUtil-SF : xBase-PC : xDryUtility-PC : xStrm-PC : xUtil-PC : xBase-GI : xStrm-GI : xUtil-GI : xArch-MI : xBase-MI : xArch-PC : xEsmt-MI : xUtil-MI : x22X34-PSF : Gate Details : xGrad-SF 13455 NOEL ROAD, TWO GALLERIA OFFICE TOWER, SUITE 700, DALLAS, TX 75240 AS NOTED ERG AGB CMDCITY OF SOUTHLAKE, TEXAS SHIVERS' FARM PRIVATE SINGLE FAMILY 067545015 PDF PDF JSB 06.29.2026FOR REVIEW ONLYNot for construction or permit purposesP.L.A.L.A. No.DatePaul D. Freeland245806/29/26 TPTPTPTPTPTPTPTPT P 32573258325932603261326232633264326532663267326832693270327132723273327432753276327732783279328032813282328332843285328632873288328932903291329232933294329532963297329832993300330133023303330433053306330733083309331033113312331333143315331633173318331933203321332233233324332533263327332833293330333133323333333433353336333733383339334033413342334333443345334633473348334933503351335233533354335533563357335833593360336133623363336433653366336733683369337033713372337333743375337633773378337933803381338233833384338533863387338833893390339133923393339433953396339733983399340034013402340334043405340634073408340934103411341234133414341534161014654.765STONE WALL B1015654.912STONE WALL C1016654.630STONE WALL END1033654.508STONE WALL B1034653.885STONE WALL END1037653.625STONE WALL B1038652.259STONE WALL END1041652.150STONE WALL B1042651.440STONE WALL END1045651.537STONE WALL B1046650.831STONE WALL END1049650.827STONE WALL B1050650.664STONE WALL C1051650.986STONE WALL C1052650.691STONE WALL C1053650.576STONE WALL C1058650.199STONE WALL END1061650.086STONE WALL B1062649.969STONE WALL END1065649.800STONE WALL B1066649.499STONE WALL END1073649.557STONE WALL B1074649.198STONE WALL END1079649.268STONE WALL B1080648.728STONE WALL END1085648.571STONE WALL B1086647.790STONE WALL END1091647.814STONE WALL B1092646.909STONE WALL END1097646.890STONE WALL B1098646.962STONE WALL END1103647.164STONE WALL B1104647.031STONE WALL C1105646.833STONE WALL C1112646.551STONE WALL END1119646.554STONE WALL B1121646.042STONE WALL END1126645.985STONE WALL B1127644.641STONE WALL END1132644.698STONE WALL B1133643.709STONE WALL END1138643.391STONE WALL B1139642.423STONE WALL END1144642.090STONE WALL B1145641.510STONE WALL C1147641.513STONE WALL C1148640.168STONE WALL C1149640.418STONE WALL C1154640.202STONE WALL END1160640.384STONE WALL B1170640.436STONE WALL END1192636.501FL 15" R.C.P.1213637.229FL 15" R.C.P.1226642.738SIGN SPEED LIMIT 401227643.871SIGN B TWO WAY1228644.005SIGN END TWO WAY1339643.722SIGN STOP/N.WHITE CHAPEL BLVD/E.KIRKWOOD BLVD1340643.485SIGN SPEED LIMIT 401353641.828FL 8" C.M.P.1354641.553FL 8" C.M.P.1370638.120FL 8" C.M.P.1611642.105CABLE VAULT COR B AT&T1612642.103CABLE VAULT COR C AT&T1613642.117CABLE VAULT COR C AT&T1614642.231CABLE VAULT COR CLOSE AT&TOHL OHL OHL OHL OHL OHL OHL OHL OHL OHL OHL OHL OHL OHL OHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHLOHL CBL CBL CBL CBL CBLCBLCBLCBLCBLCBLCBLCBLCBLCBL GASGASGASGASGASGASOHL OHLOHLOHL OHLWIRE FENCE2001655.336NOMATCH MSC ANTENNACITY OF SOUTHLAKEUTILITY EASEMENTVOL. 8405, PG. 1444D.R.T.C.T.15' DRAINAGE EASEMENTDOC. NO. D221095079O.P.R.T.C.T.OHL 17' CITY OF SOUTHLAKEUTILITY EASEMENTVOL. 8440, PG. 768D.R.T.C.T.20' WIDE RIGHT-OF-WAY EASEMENT10' WIDE PORTION OF A CALLED20' WIDE RIGHT-OF-WAY EASEMENT15' DRAINAGE EASEMENT17' WIDE UTILITY EASEMENT17' WIDE UTILITY EASEMENTW STATE HWY 114TREES OFF SITETREES IN R.O.W.TREES IN R.O.W.TREES TO BE REMOVEDTREES OFF SITETREES IN R.O.W.TREES OFF SITEE KIRKWOOD BLVDTREES TO BE PRESERVEDTREES TO BE PRESERVEDBY DATE REVISIONSNo.DATESHEET NUMBERCHECKED BY: SCALE: DESIGNED BY: DRAWN BY: KHA PROJECT 6/24/2026 PHONE: 972-770-1300 FAX: 972-239-3820 WWW.KIMLEY-HORN.COM TX F-928 © 2026 KIMLEY-HORN AND ASSOCIATES, INC. LAST SAVED 6/19/2026 10:29 AMPLOTTED BY BRIM, JESSE 6/24/2026 10:03 AMDWG PATH C:\ACC\ACCDocs\Kimley-Horn\067545015_TRADEMARK SOUTHLAKE\Project Files\CAD\Overall\PlanSheets\LandscapeDWG NAME L1.00 TREE CONSERVATION PLAN.dwg , [ L-05 ]IMAGES Aerial :XREFS x2436 : xAnno - LA : xHard : xMatchlines - LA : xPlant : xSurvey : xTree : xArch-MI : xBase-MI : xArch-GI : xBase-GI : xStrm-GI : xUtil-GI : xArch-PC : xBase-PC : xDryUtility-PC : xStrm-PC : xUtil-PC : xSite-SF : xStrm-SF : xUtil-SF : xAerial-LA : x22X34-B900 : x22X34-PSF 13455 NOEL ROAD, TWO GALLERIA OFFICE TOWER, SUITE 700, DALLAS, TX 75240 AS NOTED ERG AGB CMDCITY OF SOUTHLAKE, TEXAS SHIVERS' FARM PRIVATE SINGLE FAMILY 067545015TREE CONSERVATION PLANAScale: 1" = 80'REMOVE TREESPRESERVE TREESNORTHL-05TREE CONSERVATION PLAN PDF PDF JSB 06.29.2026FOR REVIEW ONLYNot for construction or permit purposesP.L.A.L.A. No.DatePaul D. Freeland245806/29/26 L-06TREE CONSERVATION DATA BY DATE REVISIONSNo.DATESHEET NUMBERCHECKED BY: SCALE: DESIGNED BY: DRAWN BY: KHA PROJECT 6/24/2026 PHONE: 972-770-1300 FAX: 972-239-3820 WWW.KIMLEY-HORN.COM TX F-928 © 2026 KIMLEY-HORN AND ASSOCIATES, INC. LAST SAVED 6/19/2026 10:29 AMPLOTTED BY BRIM, JESSE 6/24/2026 10:04 AMDWG PATH C:\ACC\ACCDocs\Kimley-Horn\067545015_TRADEMARK SOUTHLAKE\Project Files\CAD\Overall\PlanSheets\LandscapeDWG NAME L1.00 TREE CONSERVATION PLAN.dwg , [ L-06 ]IMAGES Aerial :XREFS x2436 : xAnno - LA : xHard : xMatchlines - LA : xPlant : xSurvey : xTree : xArch-MI : xBase-MI : xArch-GI : xBase-GI : xStrm-GI : xUtil-GI : xArch-PC : xBase-PC : xDryUtility-PC : xStrm-PC : xUtil-PC : xSite-SF : xStrm-SF : xUtil-SF : xAerial-LA : x22X34-B900 : x22X34-PSF 13455 NOEL ROAD, TWO GALLERIA OFFICE TOWER, SUITE 700, DALLAS, TX 75240 AS NOTED ERG AGB CMDCITY OF SOUTHLAKE, TEXAS SHIVERS' FARM PRIVATE SINGLE FAMILY 067545015 PDF PDF JSB 06.29.2026FOR REVIEW ONLYNot for construction or permit purposesP.L.A.L.A. No.DatePaul D. Freeland245806/29/26 12"W12"W12"W12"W12"W12"W12"W12"WOHEOHCOHCOHCOHCOHCOHCOHCOHCOHCOHCOHCOHCOHCOHCOHCOHCOHCOHCOHCOHCOHCOHCOHC OHC OHC OHC OHC OHC OHC OHC OHCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCU G C U G C UGC UGC UGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCU G C UGC UGC UGC UGC UGC UGCUGCUGCUGCUGCP P P P PPP PP P P PP P P <<<<<<<<<<<<<XXXXXX XXXXX XX650651 651 652 650 651 652 65 3 6 5 3654 6 5 2 65 1 6506 4 6 6476486496 4 5 6 4 3 6 4 4 649650 651 652 6 5 3 65 4 652 6 5 0 6 5 1 649 6496 4 0 645 6506376 3 8 6396 4 1 6 4 2 6 4 3 6 4 4 6 4 6 6476486492.1 cfs DA-D-GROVE 0.26 ac 0.3 cfs DA-D-BLDG2 0.04 ac 2.1 cfs DA-B-6 0.26 ac 11.3 cfs DA-B-7 1.37 ac 3.3 cfs DA-B-BLDG2 0.41 ac 2.4 cfs DA-B-BLDG1 0.29 ac 1.5 cfs DA-D-4 0.19 ac 2.6 cfs DA-D-BLDG1 0.32 ac 2.1 cfs DA-A-6.0 0.26 ac 2.1 cfs DA-BYPASS-SF.3 0.39 ac 1.7 cfs DA-BYPASS-SF.2 0.32 ac 2.8 cfs DA-ROW-1 0.32 ac 7.6 cfs DA-BYPASS-ROAD 0.86 ac 5.6 cfs DA-ROW-2 0.63 ac 8.4 cfs DA-B 1.02 ac 0.5 cfs DA-A-6.1 0.06 ac 3.2 cfs DA-C-5 0.38 ac 0.6 cfs DA-D-6.2 0.07 ac 4.6 cfs DA-A-6 0.56 ac 4.8 cfs DA-C-6 0.59 ac 4.5 cfs DA-C-3 0.54 ac 6.7 cfs DA-A-BLDG 0.82 ac 15.7 cfs DA-A-SF 2.92 ac 2.0 cfs DA-ROAD-C.1 0.23 ac 45.4 cfs DA-B-SF 8.45 ac 2.5 cfs DA-B-4 0.31 ac 4.6 cfs DA-B-5 0.56 ac 16.5 cfs DA-ROAD-A 1.87 ac 1.5 cfs DA-A-5 0.18 ac 22.3 cfs DA-A-OS 2.71 ac 5.1 cfs DA-C-4 0.62 ac 3.9 cfs DA-ROAD-C.2 0.44 ac 5.2 cfs DA-D-1 0.64 ac 16.3 cfs DA-A-1 1.98 ac 2.1 cfs DA-A-3 0.26 ac 2.3 cfs DA-A-2 0.28 ac 15.2 cfs POND 1.85 ac 8.6 cfs DA-BYPASS-SF.1 1.61 ac 9.2 cfs DA-ROW-3 1.05 ac 1.8 cfs DA-B-BLDG3 0.22 ac 6.8 cfs DA-ROW-4 0.78 ac 7.3 cfs DA-D 0.89 ac 2.0 cfs DA-D-5 0.24 ac 2.9 cfs DA-D-3 0.35 ac 5.3 cfs DA-C-2 0.64 ac 3.5 cfs DA-B-1 0.42 ac 0.5 cfs DA-C-BLDG3 0.06 ac 0.8 cfs DA-C-BLDG4 0.10 ac 1.3 cfs DA-B-2 0.16 ac 3.6 cfs DA-POND 0.44 ac 19.7 cfs DA-BYPASS-GI 2.40 ac 1.9 cfs DA-C-1 0.23 ac 1.2 cfs DA-A 0.15 ac 3.8 cfs DA-C-BLDG 0.46 ac WEST KIRKWOODBOULEVARDN. WHITE CHAPELBOULEVARDDRAINAGE AREA TABLE DRAINAGE AREA NO. DA-A DA-A-1 DA-A-2 DA-A-3 DA-A-5 DA-A-6 DA-A-6.0 DA-A-6.1 DA-A-BLDG DA-A-OS DA-A-SF DA-B DA-B-1 DA-B-2 DA-B-4 DA-B-5 DA-B-6 DA-B-7 DA-B-BLDG1 DA-B-BLDG2 DA-B-BLDG3 DA-B-SF DA-BYPASS-GI DA-BYPASS-ROAD DA-BYPASS-SF.1 DA-BYPASS-SF.2 DA-BYPASS-SF.3 DA-C-1 DA-C-2 DA-C-3 DA-C-4 DA-C-5 DA-C-6 DA-C-BLDG DA-C-BLDG3 DA-C-BLDG4 DA-D DA-D-1 DA-D-3 DA-D-4 DA-D-5 DA-D-6.2 DA-D-BLDG1 DA-D-BLDG2 DA-D-GROVE DA-POND DA-ROAD-A DA-ROAD-C.1 DA-ROAD-C.2 DA-ROW-1 DA-ROW-2 DA-ROW-3 DA-ROW-4 POND AREA (ac) 0.15 1.98 0.28 0.26 0.18 0.56 0.26 0.06 0.82 2.71 2.92 1.02 0.42 0.16 0.31 0.56 0.26 1.37 0.29 0.41 0.22 8.45 2.40 0.86 1.61 0.32 0.39 0.23 0.64 0.54 0.62 0.38 0.59 0.46 0.06 0.10 0.89 0.64 0.35 0.19 0.24 0.07 0.32 0.04 0.26 0.44 1.87 0.23 0.44 0.32 0.63 1.05 0.78 1.85 FREQUENCY FACTOR 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 RUNOFF COEFFICIENT "C" 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.67 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.67 0.84 0.90 0.67 0.67 0.67 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.90 0.90 0.90 0.90 0.90 0.90 0.90 0.84 RAINFALL INTENSITY "I"100 (in/hr) 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 8.02 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 8.02 9.78 9.78 8.02 8.02 8.02 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 TIME OF CONCENTRATION (minutes) 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 15.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 15.0 10.0 10.0 15.0 15.0 15.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 10.0 TOTAL FLOW Q100 (cfs) 1.2 16.3 2.3 2.1 1.5 4.6 2.1 0.5 6.7 22.3 15.7 8.4 3.5 1.3 2.5 4.6 2.1 11.3 2.4 3.3 1.8 45.4 19.7 7.6 8.6 1.7 2.1 1.9 5.3 4.5 5.1 3.2 4.8 3.8 0.5 0.8 7.3 5.2 2.9 1.5 2.0 0.6 2.6 0.3 2.1 3.6 16.5 2.0 3.9 2.8 5.6 9.2 6.8 15.2 BYDATEREVISIONSNo.DATESHEET NUMBER CHECKED BY:SCALE:DESIGNED BY:DRAWN BY:KHA PROJECT6/24/2026PHONE: 972-770-1300 FAX: 972-239-3820WWW.KIMLEY-HORN.COM TX F-928© 2026 KIMLEY-HORN AND ASSOCIATES, INC. LAST SAVED6/8/2026 5:29 PMPLOTTED BYBORAWSKI, ALINA 6/24/2026 10:53 AMDWG PATHC:\ACC\ACCDocs\Kimley-Horn\067545015_TRADEMARK SOUTHLAKE\Project Files\CAD\Private Single Family\PlanSheetsDWG NAMEC-DamExisting-Plan.dwg , [ DMAP ]IMAGESXREFS xSite-Exst-SF : xSite-Futr-SF : xBase-PC : xBase-MI : xExBase-MR : xBndry-MR : xUtil-PC : xStrm-PC : xDryUtility-PC : xUtil-MI : xStrm-MI : xEX_Dmap-SF : x22X34-PSF13455 NOEL ROAD, TWO GALLERIA OFFICE TOWER,SUITE 700, DALLAS, TX 75240AS NOTEDERGAGBCMDCITY OF SOUTHLAKE, TEXASSHIVERS' FARMPRIVATE SINGLE FAMILYCITY CASE NO. ZA26-00XX 067545015CALLED 42.5091 CARILLON CROWN, LLC INST. NO. DOC. NO. D222154040 O.P.R.T.C.T. BLOCK 4 METAIRIE AT SOUTHLAKE INST. NO. D221095079 O.P.R.T.C.T. PROPOSED COMMERCIAL (FOR REFERENCE ONLY) INLET NUMBER PROPERTY LINE PROPOSED STORM DRAIN LINE EXISTING STORM DRAIN LINE PROPOSED DRAINAGE DIVIDE PROPOSED STORM DRAIN INLET PROPOSED STORM DRAIN MANHOLE PROPOSED STORM DRAIN HEADWALL PROPOSED FLOW DIRECTION PROPOSED CONTOUR EXISTING CONTOUR LEGEND AREA IN ACRES9.9 ac X-1 5.5 cfs Q100 FLOW IN CFS AREA DESIGNATOR A-1 1.CONTRACTOR TO FIELD VERIFY HORIZONTAL AND VERTICAL LOCATION OF EXISTING UTILITIES PRIOR TO CONSTRUCTION. 2.INTENSITY SHOWN ON DRAINAGE AREA CALCULATIONS FOLLOW ISWM MANUAL DATED 2020 UNDER TARRENT COUNTY INTENSITY-DURATION DATA TABLES. 3.EXISTING DRAINAGE AREA MAP PREPARED AND PROVIDED BY SEPARATE PLAN FOR FULL PROJECT SITE. DRAINAGE GENERAL NOTES DESIGN POINT A DESIGN POINT B DESIGN POINT D DESIGN POINT E DESIGN POINT C EX. 6' X 6' DROP INLET PER METEAIRIE AT SOUTHLAKE PLANS BY DEOTTE, INC. DATED 2/27/2020. ALLOWABLE OFFSITE FLOW = 28.7 CFS NORTH 0 GRAPHIC SCALE IN FEET 100 50 100 200 EXISTING DRAINAGEAREA MAPC-400 BM 403 A SQUARE CUT WITH "X"-CUT SET ON A CURB INLET, ON THE NORTHEAST SIDE OF SH 114 FRONTAGE ROAD (NORTHBOUND), 900'+/- NORTHWEST OF THE INTERSECTION OF STATE HIGHWAY NO. 114 AND N. WHITE CHAPEL BOULEVARD. ELEV.=647.93 BM 405 A SQUARE CUT WITH "X"-CUT SET ON THE SOUTHWEST CORNER OF A CURB INLET, 538'+/- WEST OF THE CENTERLINE OF STATE HIGHWAY NO. 114 AND N. WHITE CHAPEL BOULEVARD, 610'+/- OF THE CENTERLINE OF N. WHITE CHAPEL BOULEVARD AND E. KIRKWOOD BOULEVARD. ELEV.=648.94 BENCH MARK LIST 06/29/2026 OHC OHC OHC UGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCU G C UGC UGC UGC UGC UGC UGC UGC UGC UGCUGCUGCUGCUGC UGC UGCUGCUGCUGC UGC P P P P PPP PP P P PP P D OHEOHEOHEOHE<<<<<<<<<<<<<<<<<<<<<<<OHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHED 1182638.431STORM DRAIN MANHOLE T T T T T WV WVXXX 1 234 5 6 7 8 1X-HOA BLOCK C BLOCK B 123456 7 8 9 10 11 12 13 14 15 16 17 1 2 3 4 5678 9 123 BLOCK B BLOCK B BLOCK B 1X-HOA1X-HOABLOCK D BLOCK E BLOCK E 1X-HOA1X-HOA1X-HOA 1X-HOA 1X-HOA1X-HOA 1X-HOA6.8 cfs E-3 1.27 ac 5.6 cfs G-1 1.04 ac 8.4 cfs E-2 1.56 ac 6.5 cfs E-4 1.21 ac 1.0 cfs C-3A 0.19 ac 1.1 cfs C-3 0.20 ac 5.5 cfs A-3 1.02 ac 6.6 cfs A-3A 1.23 ac 3.3 cfs F-1 0.61 ac 0.5 cfs A-3B 0.10 ac 2.1 cfs A-3C 0.39 ac 0.8 cfs C-5 0.15 ac 0.9 cfs C-4 0.17 ac 9.0 cfs G-2 1.67 ac 1.4 cfs E-1 0.26 ac 3.6 cfs E-5 0.67 ac 4.1 cfs E-6 0.77 ac 3.7 cfs F-0 0.79 ac 1.0 cfs F-1A 0.19 ac 0.9 cfs TO-A-1 0.17 ac 651 652 653 6506 5 1652650645 640 6 5 0 6 5 1652 650651652651 651 651 652 65 2 652 653 653 654654 6526 5 3 652 653 653654650651 651 652 650 651 652 653 6 5 3654 6 5 2 65 1 6506 4 6 6476486496 4 5 6 4 3 6 4 4 645650 6 43 644 6466476486496 5 1 652653649650 651 652 6 5 3 65 4 652 6 5 0 6 5 1 649 6496 4 0 645 6506376 3 8 6396 41 6 4 2 6 4 3 6 4 4 6 46 647648649654 653 653 653653 655654653654 6 5 4 653654653655655 654 655 656 656 656 655 655 653652651650652651650649648655 654 654 654 655 656 655654 654 654 655 655 656 656 655 654654 653 653 653 654 655 653 652 651 652 653 654 654654653653 DRAINAGE AREA TABLE DRAINAGE AREA NO. A-3 A-3A A-3B A-3C C-3 C-3A C-4 C-5 E-1 E-2 E-3 E-4 E-5 E-6 F-0 F-1 F-1A G-1 G-2 AREA (ac) 1.02 1.23 0.10 0.39 0.20 0.19 0.17 0.15 0.26 1.56 1.27 1.21 0.67 0.77 0.79 0.61 0.19 1.04 1.67 FREQUENCY FACTOR 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 RUNOFF COEFFICIENT "C" 0.67 0.67 0.67 0.67 0.67 0.67 0.67 0.67 0.67 0.67 0.67 0.67 0.67 0.67 0.58 0.67 0.67 0.67 0.67 RAINFALL INTENSITY "I"100 (in/hr) 8.02 8.02 8.02 8.02 8.02 8.02 8.02 8.02 8.02 8.02 8.02 8.02 8.02 8.02 8.02 8.02 8.02 8.02 8.02 TIME OF CONCENTRATION (minutes) 15.0 15.0 15.0 15.0 15.0 15.0 15.0 15.0 15.0 15.0 15.0 15.0 15.0 15.0 15.0 15.0 15.0 15.0 15.0 TOTAL FLOW Q100 (cfs) 5.5 6.6 0.5 2.1 1.1 1.0 0.9 0.8 1.4 8.4 6.8 6.5 3.6 4.1 3.7 3.3 1.0 5.6 9.0 BYDATEREVISIONSNo.DATESHEET NUMBER CHECKED BY:SCALE:DESIGNED BY:DRAWN BY:KHA PROJECT6/24/2026PHONE: 972-770-1300 FAX: 972-239-3820WWW.KIMLEY-HORN.COM TX F-928© 2026 KIMLEY-HORN AND ASSOCIATES, INC. LAST SAVED6/8/2026 4:39 PMPLOTTED BYBORAWSKI, ALINA 6/24/2026 10:53 AMDWG PATHC:\ACC\ACCDocs\Kimley-Horn\067545015_TRADEMARK SOUTHLAKE\Project Files\CAD\Private Single Family\PlanSheetsDWG NAMEC-PropDam-Plan.dwg , [ DMAP ]IMAGESXREFS xSite-SF : xSite-Exst-SF : xStrm-SF : xSite-Futr-SF : xBase-PC : xBase-MI : xExBase-MR : xBndry-MR : xUtil-PC : xStrm-PC : xDryUtility-PC : xUtil-MI : xStrm-MI : xDmap-SF : xGrad-SF : x22X34-PSF13455 NOEL ROAD, TWO GALLERIA OFFICE TOWER,SUITE 700, DALLAS, TX 75240AS NOTEDERGAGBCMDCITY OF SOUTHLAKE, TEXASSHIVERS' FARMPRIVATE SINGLE FAMILYCITY CASE NO. ZA26-00XX 067545015PROPOSED DRAINAGEAREA MAPC-401 CALLED 42.5091 CARILLON CROWN, LLC INST. NO. DOC. NO. D222154040 O.P.R.T.C.T. CARILLON PHASE 1A INST.NO. D211101073 P.R.T.C.T. BLOCK A THRASHER ADDITION CAB. 388-202, PG. 73 P.R.T.C.T. CALLED 1.82 ACRES PANORAMA PROPERTIES, LTD. DOC. NO. D206290483 O.P.R.T.C.T. BLOCK 4 METAIRIE AT SOUTHLAKE INST. NO. D221095079 O.P.R.T.C.T. UTLEY WAY UTLEY WAYPURYEAR PLACE PURYEAR PLACEPURYEAR PLACEPURYEAR PLACEN. WHITE CHAPEL BOULEVARDPROPOSED ROADWAY IMPROVEMENTS (BY PWC26-0002) (FOR REFERENCE ONLY) WEST KIRKWOOD BOULEVARDWEST KIRKWOOD BOULEVARDPROPOSED COMMERCIAL (BY SEPARATE PLANS) (FOR REFERENCE ONLY) PROPOSED COMMERCIAL (BY PWC26-0003) (FOR REFERENCE ONLY) 20' DRAINAGE ESMT 5' WALL MAINTENANCE ESMT 15' DRAINAGE ESMT 5' WALL MAINTENANCE ESMT 15' SSWR ESMT INLET NUMBER PROPERTY LINE PROPOSED STORM DRAIN LINE EXISTING STORM DRAIN LINE PROPOSED DRAINAGE DIVIDE PROPOSED STORM DRAIN INLET PROPOSED STORM DRAIN MANHOLE PROPOSED STORM DRAIN HEADWALL PROPOSED FLOW DIRECTION PROPOSED CONTOUR EXISTING CONTOUR LEGEND AREA IN ACRES9.9 ac X-1 5.5 cfs Q100 FLOW IN CFS AREA DESIGNATOR A-1 1.CONTRACTOR TO FIELD VERIFY HORIZONTAL AND VERTICAL LOCATION OF EXISTING UTILITIES PRIOR TO CONSTRUCTION. 2.INTENSITY SHOWN ON DRAINAGE AREA CALCULATIONS FOLLOW ISWM MANUAL DATED 2020 UNDER TARRENT COUNTY INTENSITY-DURATION DATA TABLES. 3.EXISTING DRAINAGE AREA MAP PREPARED AND PROVIDED BY SEPARATE PLAN FOR FULL PROJECT SITE. DRAINAGE GENERAL NOTES 10' PRIVATE DRAINAGE ESMT EX. 20' ELECTRIC ESMT A-3C A-3B A-3 A-3A EX A-1 F-1 F-1A C-5C-4 C-3AC-3 E-2 E-1 E-4 E-3 E-5 E-6 G-1 G-2 DESIGN POINT A DESIGN POINT B DESIGN POINT C DESIGN POINT D DESIGN POINT E EX. 6' X 6' DROP INLET PER METEAIRIE AT SOUTHLAKE PLANS BY DEOTTE, INC. DATED 2/27/2020. ALLOWABLE OFFSITE FLOW = 28.7 CFS PROPOSED FLOW PER PWC26-0002 MAJOR INFRASTRUCTURE PLANS IS 25.34 CFS (FLOW ALLOWABLE FROM SF TRACT = 8.48 CFS) NORTH 0 GRAPHIC SCALE IN FEET 60 30 60 120 BM 403 A SQUARE CUT WITH "X"-CUT SET ON A CURB INLET, ON THE NORTHEAST SIDE OF SH 114 FRONTAGE ROAD (NORTHBOUND), 900'+/- NORTHWEST OF THE INTERSECTION OF STATE HIGHWAY NO. 114 AND N. WHITE CHAPEL BOULEVARD. ELEV.=647.93 BM 405 A SQUARE CUT WITH "X"-CUT SET ON THE SOUTHWEST CORNER OF A CURB INLET, 538'+/- WEST OF THE CENTERLINE OF STATE HIGHWAY NO. 114 AND N. WHITE CHAPEL BOULEVARD, 610'+/- OF THE CENTERLINE OF N. WHITE CHAPEL BOULEVARD AND E. KIRKWOOD BOULEVARD. ELEV.=648.94 BENCH MARK LIST 06/29/2026 12"W12"W12"W12"W8"WP P P OHEOHEOHEOHEOHEOHE<<<<<<<<<<<<<<<OHEOHEOHEOHEOHEOHEOHEOHEOHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHEOHEOHEF D 1182638.431STORM DRAIN MANHOLE GASGASGASGASGASGAS GAS GAS CBLCBLCBLCBL CBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLWV WVXXXXXX650651652651652 652 651 6 5 1 6 4 0645650 6396 4 1 64 2 6 43 644 6466476 4 8 64 9 6 5 1 6526536 4 0 6 3 7 6 3 8 6396 4 1 6 42 6 4 3 65 1 6 5 2 6 5 3 6 4 5 6506 4 4 6 4 6647648649 65165 0 645646647650EB 0.6'EB 0.4'EB 0.2'EB 0.1'EB 0.3'1 2 3456789 123 BLOCK D BLOCK E BLOCK E 1X-HOA1X-HOA 1X-HOA UTLEY WAY UTLEY WAYTYPE ATYPE ATYPE ATYPE ATYPE A TYPE A TYPE A TYPE A TYPE A TYPE A TYPE B TYPE B EX 654.4 EX 651.2 EX 649.8 EX 649.3 EX 647.4 EX 645.5 EX 643.1 EX 639.9 EX 637.7 EX 644.8 EX 645.6EX 649.6EX 650.8EX 651.0 EX 650.3 EX 650.1 EX 651.9 653.1 653.0 653.0 653.1 653.1 653.2 652.8 653.0 653.2 653.4 653.5653.3 652.1 651.8 650.7 652.7 651.8 651.6 652.0 652.3 653.2 651.4 651.7 652.6 651.9 652.2 653.1 652.5 652.8 653.7 653.2 653.5 652.6 651.8 652.1 651.2 653.1 652.2 651.9 652.6 651.7 651.4 653.0 652.1 651.8 FP 655.0 FP 653.4 FP 653.7 FP 654.2 FP 653.6FP 654.1 FP 653.8 FP 653.7 FP 654.3 FP 653.8 FP 652.4FP 654.0 EX/EW 654.3 TW 654.8 TW 654.2 TW 653.3 TW 653.8 TW 654.4 TW 650.0 BW 653.3 BW 651.7 BW 650.3 BW 649.8 BW 647.9 BW 646.0 BW 643.6 BW 640.0 TW 654.0 TW/BW 652.0 EW 652.6 TW 652.6 TW/BW 650.6 EW 651.2 653.7 653.5 653.4 654.0 654.7 EW 6 5 3 . 3 TW 654.4 TW 653.6 TW 653.6 TW 652.0TW 652.2TW 650.5TW 650.5TW 650.5TW 650.6TW 649.7BW 651.1 BW 649.6 BW 647.6 650.6 651.6 652.2 653.1 653.2 BW 645.5BW 644.2BW 644.5BW 644.2651.2 651.0 651.5 652.1 653.1 EW 653.6 EW 653.6BW 653.3 BW 653.3TW 654.3 TW 653.8 653.8 653.3 653.1 653.9653.4 651.4 651.3 651.7 651.0 651.0 651.0 TW 653.8 BW 653.5 BW 644.5BW 644.6BW 644.5FL: 650.6 FL: 649.2 FL: 648.4 FL: 647.0 FL: 645.0 FL: 642.6 FL: 639.4 EB 0.9'EX 644.3 EX 643.5 EX 643.2 EX 642.1 EX 641.7 EX 641.3 EX 641.1 EX 640.2 EX 639.9 EX 639.1 FL: 643.5 FL: 642.7 FL: 642.2 FL: 640.7 FL: 640.2 FL: 640.0 FL: 639.2 FL: 638.9 FL: 638.1 EX 637.6 TC: 651.15 TC: 651.42TC: 650.99 TC: 651.51 TC: 651.29 TC: 651.29 TC: 651.69 TC: 651.69 TC: 652.44 TC: 652.44 TC: 652.95 TC: 652.95 TC: 651.06 TC: 651.06 TC: 652.98TC: 652.98TC: 651.97TC: 651.93TC: 650.81TC: 650.34TC: 650.84TC: 650.17EX 649.2EX 650.1 HP/TC: 651.84 HP/TC: 651.84 LP/TC: 651.19 LP/TC: 651.19 HP/TC: 653.02 TC: 650.65 TC: 650.65 LP/TC: 650.34 FL: 654.0 EB 0.4' 17' CITY OF SOUTHLAKE UTILITY EASEMENT VOL.8440, PG. 768 D.R.T.C.T. 15' DRAINAGE EASEMENT DOC. NO. D221095079 O.P.R.T.C.T. 10' PEDESTRIAN EASEMENT DOC. NO. D207152978 O.P.R.T.C.T.CITY OF SOUTHLAKE UTILITY EASEMENT VOL. 8405, PG. 1444 D.R.T.C.T. PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT EXISTING 20' UTILITY EASEMENTPAE & UDE50'50'50' PAE & UDE PAE & UDE12"W 12"W 12"W 12"W12"W<OHEF GASTCBLCBLCBLCBLCBLPROPOSED ROADWAY IMPROVEMENTS (BY PWC26-0002) (FOR REFERENCE ONLY) 650 645646647EX 649.8EX 650.7 BYDATEREVISIONSNo.DATESHEET NUMBER CHECKED BY:SCALE:DESIGNED BY:DRAWN BY:KHA PROJECT6/24/2026PHONE: 972-770-1300 FAX: 972-239-3820WWW.KIMLEY-HORN.COM TX F-928© 2026 KIMLEY-HORN AND ASSOCIATES, INC. LAST SAVED6/24/2026 10:48 AMPLOTTED BYBORAWSKI, ALINA 6/24/2026 10:52 AMDWG PATHC:\ACC\ACCDocs\Kimley-Horn\067545015_TRADEMARK SOUTHLAKE\Project Files\CAD\Private Single Family\PlanSheetsDWG NAMEC-Grading-Plan.dwg , [ Grading Plan ]IMAGESXREFS xGrad-SF : xSite-SF : xSite-Exst-SF : xStrm-SF : xSite-Futr-SF : xBase-PC : xBase-MI : xExBase-MR : xBndry-MR : xUtil-PC : xStrm-PC : xDryUtility-PC : xUtil-MI : xStrm-MI : x22X34-PSF : xHard13455 NOEL ROAD, TWO GALLERIA OFFICE TOWER,SUITE 700, DALLAS, TX 75240AS NOTEDERGAGBCMDCITY OF SOUTHLAKE, TEXASSHIVERS' FARMPRIVATE SINGLE FAMILYCITY CASE NO. ZA26-00XX 067545015BM 403 A SQUARE CUT WITH "X"-CUT SET ON A CURB INLET, ON THE NORTHEAST SIDE OF SH 114 FRONTAGE ROAD (NORTHBOUND), 900'+/- NORTHWEST OF THE INTERSECTION OF STATE HIGHWAY NO. 114 AND N. WHITE CHAPEL BOULEVARD. ELEV.=647.93 BM 405 A SQUARE CUT WITH "X"-CUT SET ON THE SOUTHWEST CORNER OF A CURB INLET, 538'+/- WEST OF THE CENTERLINE OF STATE HIGHWAY NO. 114 AND N. WHITE CHAPEL BOULEVARD, 610'+/- OF THE CENTERLINE OF N. WHITE CHAPEL BOULEVARD AND E. KIRKWOOD BOULEVARD. ELEV.=648.94 BENCH MARK LIST 3' PROPERTY LINE PROPOSED FINISHED PAD ELEVATION PROPOSED SPOT ELEVATION EXISTING SPOT ELEVATION PROPOSED TOP OF WALL ELEVATION PROPOSED BOTTOM OF WALL ELEVATION PROPOSED END WALL ELEVATION PROPOSED REAR YARD SWALE LOT DRAINAGE FLOW DIRECTION STREET DRAINAGE FLOW DIRECTION PROPOSED RETAINING WALL EXPOSED FACE OF RETAINING WALL INDICATES SIDE OF LOT WHERE DRIVEWAY MUST BE LOCATED DUE TO GRADE DIFFERENTIAL OR CONFLICT EXPOSED BEAM REQUIRED DROP GARAGE REQUIRED PROPOSED CONTOUR EXISTING CONTOUR EXISTING TREE TO REMAIN PEDESTRIAN ACCESS EASEMENT & UTILITY AND DRAINAGE EASEMENT LEGEND EB FP 675.00 EX 55.5 55.5 * TW 55.5 BW 55.5 EW 55.5 DG PAE & UDE SIDE SL O P E SIDE S W A L E PROTECTIVE FRONT SLOPEPARKWAY SLOPESTREETREAR SLOPELOT GRADING TYPE A ALL DRAINAGE TO STREET - ALL LOTS, UNLESS OTHERWISE NOTED. P GRADING AT SIDE YARD WALL 1' RETAINING WALL FINISHED FLOOR FINISHED FLOOR 0.3' 4:1 SLOPE (MAX) 4:1 SLOPE (MAX) L 2' 2' 0.3' NTS GRADING GENERAL NOTES 1.CONTRACTOR SHALL CUT 5' BEHIND BACK OF CURB TO SUBGRADE ELEVATION. 2.PROPOSED PRIVATE RETAINING WALLS LOCATED ON PRIVATE LOTS TO BE MAINTAINED BY THE PROPERTY OWNER. 3.GLOBAL STABILITY AND STRUCTURAL DESIGN OF RETAINING WALLS PROVIDED BY OTHERS. 4.THE END ELEVATION CALLS FOR RETAINING WALLS DEPICT GROUND ELEVATION. TOP OF WALL ELEVATIONS ARE TYPICALLY 0.5' ABOVE GROUND. 5.ALL PERIMETER SLOPES TO NATURAL GROUND ARE TO BE 4:1 MAX, UNLESS OTHERWISE NOTED. 6.ALL SIDEWALKS SHALL MAINTAIN A MAXIMUM 2% CROSS SLOPE. 7.PROPOSED CONTOURS SHOWN ARE FOR REFERENCE ONLY. CONTRACTOR TO USE SPOT ELEVATIONS FOR GRADING CONSTRUCTION. 8.PRIVATE DRAINAGE EASEMENT PROPOSED ALONG THE NORTHERN BOUNDARY OF BLOCK E SHALL BE MAINTAINED BY THE HOA. 9.BLOCK E, LOTS 3 THROUGH 9 SHALL HAVE REAR LOT FENCING PLACED ON THE SOUTHERN SIDE OF THE PROPOSED PRIVATE DRAINAGE EASEMENT. 10.MOISTURE CONDITIONING OF LOTS SHALL ULTIMATELY BE THE RESPONSIBILITY OF THE HOME BUILDER TO PERFORM AND VERIFY. MATCH LINE SEE SHEET C-301 BLOCK 4 METAIRIE AT SOUTHLAKE INST. NO. D221095079 O.P.R.T.C.T. CARILLON PHASE 1A INST.NO. D211101073 P.R.T.C.T. 5' WALL MAINTENANCE ESMT 15' DRAINAGE ESMT EXISTINGN. WHITE CHAPEL BOULEVARD(COUNTY ROAD 3016)(FOR REFERENCE ONLY)W KIRKWOOD BOULEVARDW KIRKWOOD BOULEVARD10' PRIVATE DRAINAGE ESMT (SEE NOTE 8) EXISTING 20' ELECTRICAL ESMT 8'8' VARIES VARIES145' MIN.83' MIN. TYPICAL LOT DIMENSION DETAIL (NORTHERN TRACT) NTS25'MIN30'MIN.PROTECTIVE REAR SLOPESIDE SL O P E SIDE S W A L E PROTECTIVE FRONT SLOPEPARKWAY SLOPESTREETSIDE S W A L E LOT GRADING TYPE B DRAINAGE BOTH TO STREET & REAR LOT LINE - BLOCK E LOT 3 & LOT 4 WILL BE TYPE B.A-AA-A***** ** 4:1 M A X 1% TYP. VARIES 3' 3' F-F PROPOSED RETAINING WALL (HEIGHT VARIES) EXISTING RETAINING WALL (HEIGHT VARIES) VARIES CROSS SECTION A-A NTS CONCRETE FLUME - TO BE BUILT PER CITY DETAIL INCLUDED IN THESE PLANS ROCK RIP RAP - IN ACCORDANCE WITH CONCRETE FLUME DETAIL LEGEND PROPERTY BOUNDARY PROPOSED LOT FENCING EXISTING GRADE PROPOSED GRAD E EX. 20' ELECTRIC EASEMENT PL *** RETAINING WALL KEY A B FACE OF RETAINING WALL TO BE LOCATED ON PROPERTY LINE BACK OF RETAINING WALL TO BE LOCATED ON PROPERTY LINE AB A A A A A A A A A A 0 GRAPHIC SCALE IN FEET 40 20 40 80 NORTH GRADING PLAN(1 OF 2)C-300 06/29/2026 \\8"W 8"W 12"W 12"W 12"W 12"W 12"W 12"W12"WP PPP PP P P PP P 8"SS8"W8"W8"W8"W8"W 8"W 8"W 8"W 8"W 8"W8"SS8"SSS DWFWD S T W E W W<<<<<<<<<<<<<<<<<<<<<OHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHE8"SS F F XGASGASGASGAS GAS T T CBLCBLCBLCBLCBL CBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBL CBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFL FL FL FL FL FL FL FL FL FL T3PT3PT3P 5' WALL MAINTENANCE ESMT652 653654652 653652 EXISTINGN. WHITE CHAPEL BOULEVARD(COUNTY ROAD 3016)(FOR REFERENCE ONLY)PROPOSED COMMERCIAL (BY PWC26-0003) (FOR REFERENCE ONLY) PROPOSED ROADWAY IMPROVEMENTS (BY PWC26-0002) (FOR REFERENCE ONLY)653651650649649649650 6 5 1 65 26536 5 4 6 4 5 646647648649650 645646647EB 0.1'EB 0.7'EB 0.5'EB 0.3'EB 0.1'1234 5 6 7 8 1X-HOA BLOCK C BLOCK B 123456 7 8 9 10 11 12 13 14 15 16 17BLOCK B BLOCK B BLOCK B 1X-HOA1X-HOA1X-HOA1X-HOA1X-HOA 1X-HOAPURYEAR PLACE PURYEAR PLACEPURYEAR PLACEPURYEAR PLACETYPE A TYPE A TYPE A TYPE A TYPE ATYPE ATYPE ATYPE ATYPE ATYPE A TYPE A TYPE A TYPE A TYPE A TYPE A TYPE A TYPE A TYPE A TYPE A TYPE A TYPE A TYPE ATYPE A TYPE A TYPE A EX 651.4EX 652.3 EX 653.1 EX 650.3 EX 646.8 EX 646.9 EX 652.3 EX/BW 654.0EX/BW 654.2EX/EW 655 .1 EX/EW 655.0 EX/EW 655.7 EX/EW 655.7 652.1 653.1 653.3 653.6 653.8 653.4 653.8 654.1 654.8 652.8 652.1 651.8 654.4 654.7 655.4 653.4 652.7 652.4 654.3 654.6 655.3 654.0 653.3 653.0 654.2 653.6 653.2 EX 655.7EX 655.5 EX 654.6 EX 653.9 EX 653.9 EX 654.7 EX 654.7 EX 654.6 EX 654.6 EX 654.8 EX 654.5 EX 654.3 653.3 653.4 654.0 653.5 653.4 653.5 653.4 653.2 652.6 653.0 652.8 652.5 652.2 651.7 653.5 652.5 652.2 653.8 652.9 652.5 653.6 652.8 652.5 652.0 652.3 653.0 652.8 653.2 653.8 652.7 653.0 653.7 653.3 653.6 654.3 653.2 653.5 654.2 652.6 651.9 651.6 654.9 654.1 654.9 654.2 653.9 655.5 654.8 654.5 655.1 654.4 654.1 654.5 653.8 653.5 652.9 652.2 651.9 653.0 652.3 652.0 652.7 651.8 651.5 FP 656.3FP 654.9FP 654.3 FP 654.1 FP 653.9 FP 653.9 FP 653.5 FP 655.7FP 656.1FP 656.1FP 655.7FP 655.3FP 655.2 FP 654.4 FP 654.2 FP 654.8FP 654.6FP 654.0FP 653.6 FP 655.9FP 656.2FP 656.0FP 655.4 FP 655.0 FP 654.7 652.6655.0 655.8 656.2 654.0 654.6 656.0 653.3 653.7 654.3 654.5 652.8 655.1 655.7 655.9 655.6 652.5 655.4655.8655.8655.4655.0654.9 654.1 653.9 654.4 654.7 653.8 653.6 653.6 653.2 653.1 652.2 652.0 652.5 652.4 651.6 651.8 653.7 653.0 653.7 654.2 653.5 654.0652.1 652.0652.0 651.5 651.2 651.0 656.2EW 653.7TW 654.0 TW 654.5 TW 655.6 TW 656.9 BW 653.0 BW 652.0 BW 650.1 BW 649.9 BW 652.7BW 653.2TW 654.7TW 655.7TW 654.2BW 652.7EX 654.6 EX 654.7 EX 654.9 EX 655.0 EX 654.5 653.4 653.6 653.9 653.7 653.5TW 652.7EW 652.6TW 654.2TW 654.3BW 651.9BW 652.2BW 651.7EX/BW 654.8 EX/BW 655.2 EX/BW 654.8 TW 655.2 TW 655.0 TW 655.8 TW 656.2 TW 655.7 EX 649.8EX 650.7 TC: 650.98TC: 650.71TC: 651.54TC: 651.54TC: 651.83TC: 651.83TC: 652.13TC: 651.63 TC: 651.50 LP/TC: 651.29 LP/TC: 651.29 LP/TC: 651.33LP/TC: 651.33LP/TC: 651 .79LP/TC: 651 .79LP/TC: 652.26LP/TC: 652.26HP/TC: 651 . 8 9 HP/TC: 651 . 8 9 HP / TC : 6 5 2 . 3 5 HP / T C : 6 5 2 . 3 5 HP/TC: 654.07TC: 652.25 TC: 653.00 TC: 653.82 TC: 654.30 TC: 653.55 TC: 653.55 TC: 653.27TC: 653.08 TC: 653.08 TC: 653.82 TC: 654.30 TC: 653.55 TC: 653.51TC: 652.83TC: 652.34TC: 653.22TC: 653.22TC: 653.36 TC: 653.79TC: 653.00TC: 652.25 TC: 651.65 TC: 651.65 TC: 6 5 1. 5 7 TC: 6 5 1. 5 7 T C : 6 5 2 . 1 3TC: 651.44TC: 652.80TC: 652 .11 TC : 6 5 2 . 2 0 HP/TC: 654.34 HP/TC: 654.3465165165 2 654 653652653651 PROPOSED 20' DRAINAGE EASEMENT PROPOSED 15' SEWER EASEMENT PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT EXISTING 20' UTILITY EASEMENT PROPOSED 15' SEWER EASEMENT PROPOSED 5' UTILITY EASEMENT 50'50'PAE & UDEPAE & UDE8"W<<OHEGASCBLCBLCBLCBLCBLCBLWV 65 0 645646647EX 645.6EX 649.6EX 650.8EX 651.0 EX 649.2EX 650.1 EXISTING 20' UTILITY EASEMENT BYDATEREVISIONSNo.DATESHEET NUMBER CHECKED BY:SCALE:DESIGNED BY:DRAWN BY:KHA PROJECT6/24/2026PHONE: 972-770-1300 FAX: 972-239-3820WWW.KIMLEY-HORN.COM TX F-928© 2026 KIMLEY-HORN AND ASSOCIATES, INC. LAST SAVED6/24/2026 10:48 AMPLOTTED BYBORAWSKI, ALINA 6/24/2026 10:52 AMDWG PATHC:\ACC\ACCDocs\Kimley-Horn\067545015_TRADEMARK SOUTHLAKE\Project Files\CAD\Private Single Family\PlanSheetsDWG NAMEC-Grading-Plan.dwg , [ Grading Plan (2) ]IMAGESXREFS xGrad-SF : xSite-SF : xSite-Exst-SF : xStrm-SF : xSite-Futr-SF : xBase-PC : xBase-MI : xExBase-MR : xBndry-MR : xUtil-PC : xStrm-PC : xDryUtility-PC : xUtil-MI : xStrm-MI : x22X34-PSF : xHard13455 NOEL ROAD, TWO GALLERIA OFFICE TOWER,SUITE 700, DALLAS, TX 75240AS NOTEDERGAGBCMDCITY OF SOUTHLAKE, TEXASSHIVERS' FARMPRIVATE SINGLE FAMILYCITY CASE NO. ZA26-00XX 067545015BM 403 A SQUARE CUT WITH "X"-CUT SET ON A CURB INLET, ON THE NORTHEAST SIDE OF SH 114 FRONTAGE ROAD (NORTHBOUND), 900'+/- NORTHWEST OF THE INTERSECTION OF STATE HIGHWAY NO. 114 AND N. WHITE CHAPEL BOULEVARD. ELEV.=647.93 BM 405 A SQUARE CUT WITH "X"-CUT SET ON THE SOUTHWEST CORNER OF A CURB INLET, 538'+/- WEST OF THE CENTERLINE OF STATE HIGHWAY NO. 114 AND N. WHITE CHAPEL BOULEVARD, 610'+/- OF THE CENTERLINE OF N. WHITE CHAPEL BOULEVARD AND E. KIRKWOOD BOULEVARD. ELEV.=648.94 BENCH MARK LIST PROPERTY LINE PROPOSED FINISHED PAD ELEVATION PROPOSED SPOT ELEVATION EXISTING SPOT ELEVATION PROPOSED TOP OF WALL ELEVATION PROPOSED BOTTOM OF WALL ELEVATION PROPOSED END WALL ELEVATION PROPOSED REAR YARD SWALE LOT DRAINAGE FLOW DIRECTION STREET DRAINAGE FLOW DIRECTION PROPOSED RETAINING WALL EXPOSED FACE OF RETAINING WALL INDICATES SIDE OF LOT WHERE DRIVEWAY MUST BE LOCATED DUE TO GRADE DIFFERENTIAL OR CONFLICT EXPOSED BEAM REQUIRED DROP GARAGE REQUIRED PROPOSED CONTOUR EXISTING CONTOUR EXISTING TREE TO REMAIN PEDESTRIAN ACCESS EASEMENT & UTILITY AND DRAINAGE EASEMENT LEGEND EB FP 675.00 EX 55.5 55.5 * TW 55.5 BW 55.5 EW 55.5 DG PAE & UDE SIDE SL O P E SIDE S W A L E PROTECTIVE FRONT SLOPEPARKWAY SLOPESTREETREAR SLOPELOT GRADING TYPE A ALL DRAINAGE TO STREET - ALL LOTS, UNLESS OTHERWISE NOTED. 8'8' VARIES VARIES125' MIN.80' MIN. TYPICAL LOT DIMENSION DETAIL (SOUTHERN TRACT) NTS25'MIN30'MIN.GRADING GENERAL NOTES 1.CONTRACTOR SHALL CUT 5' BEHIND BACK OF CURB TO SUBGRADE ELEVATION. 2.PROPOSED PRIVATE RETAINING WALLS LOCATED ON PRIVATE LOTS TO BE MAINTAINED BY THE PROPERTY OWNER. 3.GLOBAL STABILITY AND STRUCTURAL DESIGN OF RETAINING WALLS PROVIDED BY OTHERS. 4.THE END ELEVATION CALLS FOR RETAINING WALLS DEPICT GROUND ELEVATION. TOP OF WALL ELEVATIONS ARE TYPICALLY 0.5' ABOVE GROUND. 5.ALL PERIMETER SLOPES TO NATURAL GROUND ARE TO BE 4:1 MAX, UNLESS OTHERWISE NOTED. 6.ALL SIDEWALKS SHALL MAINTAIN A MAXIMUM 2% CROSS SLOPE. 7.PROPOSED CONTOURS SHOWN ARE FOR REFERENCE ONLY. CONTRACTOR TO USE SPOT ELEVATIONS FOR GRADING CONSTRUCTION. 8.PRIVATE DRAINAGE EASEMENT PROPOSED ALONG THE NORTHERN BOUNDARY OF BLOCK E SHALL BE MAINTAINED BY THE HOA. 9.BLOCK E, LOTS 3 THROUGH 9 SHALL HAVE REAR LOT FENCING PLACED ON THE SOUTHERN SIDE OF THE PROPOSED PRIVATE DRAINAGE EASEMENT. 10.MOISTURE CONDITIONING OF LOTS SHALL ULTIMATELY BE THE RESPONSIBILITY OF THE HOME BUILDER TO PERFORM AND VERIFY. MATCH LINE SEE SHEET C-300 W KIRKWOOD BOULEVARD * * * ** *** * A A A AA * * RETAINING WALL KEY A B FACE OF RETAINING WALL TO BE LOCATED ON PROPERTY LINE BACK OF RETAINING WALL TO BE LOCATED ON PROPERTY LINE P GRADING AT SIDE YARD WALL 1' RETAINING WALL FINISHED FLOOR FINISHED FLOOR 0.3' 4:1 SLOPE (MAX) 4:1 SLOPE (MAX) L 2' 2' 0.3' NTS GRADING PLAN(2 OF 2)C-301 NORTH 0 GRAPHIC SCALE IN FEET 40 20 40 80 06/29/2026 \\\\\\ \\ \\ \\ \\ \\ \\\\\\\\\ \ \\ \\\\\\W W SSSS SSSSSSSSSSSSSSW W SSSSSSSSSSSSSSSSSSSSSSSSSSSS S S S S S S S S S SS S S S S S S SS S S S 8"SS 8"SS 8"SS 8"W 8"W 8"W8 "W 8"W 8"W 8"W 8"W 8"W8"WS S S 8"W 8"W 8"W 8"W 8"W8"W 12"W 12"W 12"W12"W12"W12"WUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEOHC UGE UGE UGE UGE UGE UGE UGE UGE UGE UGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGE UGE UGE UGE UGE UGE UGE UGE UGE UGE UGE UGEUGEUGEUGEUGEUGE UGE UGE UGEUGE UGE UGE UGE UGE UGEUGEUGEUGEUGEUGEUGEUGE UGE UGEUGEUGE UGE UGE UGE P P P P PPP PP P P PP P 8"W8"W8"W8"W 8"W 8"W 8"W 8"W8"SS S W D S T W E E E W WOHEOHEOHEOHE<<<<<<<<<<<<<<<<<<<<<<<OHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE8"SS F F F D 1182638.431STORM DRAIN MANHOLE GASGAS T T T T T T CBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBL CBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLWV WV FLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFL FL FL FL FL FL FL FLT3PT3PT3PT3P MURANO PLACE (51' RIGHT-OF-WAY) 1 23 4 5 6 7 8 1X-HOA BLOCK C BLOCK B 1234 5 6 7 8 9 10 11 12 13 14 15 16 17 1 2 3456789 123 BLOCK B BLOCK B BLOCK B 1X-HOA1X-HOABLOCK D BLOCK E BLOCK E 1X-HOA1X-HOA 1X-HOA 1X-HOA1X-HOA 2+00 3+00 4+005+006+007+008+009+00 2+002+00 3+00 4+00 5+00 6+00 WL -SF A WL-SF B WL-SF BWL-SF A WL SF-CWL SF-C 2+003+00 4+00 5+00 6 + 0 0 7+00PC STA: 3+95.80 PC STA: 6+37.08 PT STA: 4+13.69 PT STA: 7+12.09 C1 STA: 4+31.07, WL-SF A INSTALL: 11.25° BEND N: 7037645.55 E: 2382043.27 STA: 4+64.93, WL-SF A INSTALL: 11.25° BEND N: 7037635.71 E: 2382010.88 STA: 4+91.25, WL-SF A INSTALL: 11.25° BEND N: 7037623.29 E: 2381987.67 STA: 5+25.11, WL-SF A INSTALL: 11.25° BEND N: 7037601.80 E: 2381961.51 STA: 5+51.43, WL-SF A INSTALL: 45° BEND N: 7037581.45 E: 2381944.82 STA: 5+76.01, WL-SF A INSTALL: 45° BEND N: 7037556.89 E: 2381945.96 STA: 7+66.18, WL-SF A STA: 9+44.17, WL-SF B INSTALL: 22.5° BEND N: 7037404.98 E: 2382058.50 STA: 9+22.79, WL-SF B INSTALL: 45° BEND N: 7037390.96 E: 2382074.63 STA: 9+13.08, WL-SF B INSTALL: 1 - FH ASSEMBLY 1 - 8" GATE VALVE (E) N: 7037391.05 E: 2382084.35 STA: 5+84.16, WL-SF B INSTALL: 45° BEND N: 7037394.05 E: 2382413.25 STA: 5+60.05, WL-SF B INSTALL: 45° BEND N: 7037411.25 E: 2382430.15 STA: 5+53.60, WL-SF B INSTALL: 1 - FH ASSEMBLY 1 - 8" GATE VALVE (N) N: 7037417.70 E: 2382430.09 STA: 3+36.94, WL-SF B INSTALL: 45° BEND N: 7037634.36 E: 2382428.11 STA: 3+12.82, WL-SF B INSTALL: 45° BEND N: 7037651.25 E: 2382410.91 STA: 2+76.14, WL-SF A STA: 1+00.00, WL-SF B INSTALL: 1 - 8"X8" TEE 2 - 8" GATE VALVES (N & E) N: 7037649.31 E: 2382198.09 STA: 1+00.00, WL-SF B INSTALL: 1 - FH ASSEMBLY N: 7037705.81 E: 2382197.58 STA: 1+00.00, WL-SF A CONNECT TO EX. 8" WL N: 7037825.44 E: 2382196.49 STA: 1+00.00, WL SF-C CONNECT TO EX. 8" WL N: 7038083.92 E: 2381878.64 STA: 2+51.26, WL SF-D INSTALL: 1 - FH ASSEMBLY 1 - 8" GATE VALVE (W) N: 7038087.00 E: 2382216.55 STA: 4+94.42, WL SF-C STA: 2+51.26, WL SF-D INSTALL: 1 - 8"X8" TEE 2 - 8" GATE VALVES (S & E) N: 7038087.52 E: 2382273.05 STA: 6+58.42, WL SF-C INSTALL: 1 - FH ASSEMBLY N: 7038089.01 E: 2382437.04 STA: 1+00.00, WL SF-D CONNECT TO EX. 8" WL N: 7037936.26 E: 2382274.4310'10' 12.0'8.0 ' 1 5 . 0 ' 32.0' 7.0' 46.0' 7.0' 32.0' 30.0'18.0'41.0' C2STA: ???, WL SF-D INSTALL: 1 - FH ASSEMBLY 1 - 8" GATE VALVE (SE) N: 7037552.63 E: 2381950.00 STA: 1+11.46, WL SF-C INSTALL: 1 - FH ASSEMBLY N: 7038084.02 E: 2381890.10 STA: 1+06.47, WL SF-D INSTALL: 1 - 2" IRRIGATION SERVICE N: 7037942.73 E: 2382274.37 STA: 3+81.76, WL-SF A INSTALL: 1 - 2" IRRIGATION SERVICE N: 7037648.35 E: 2382092.47 WL SF-DWL-SF ASTA: 3+43.39, WL-SF B INSTALL: 1 - FH ASSEMBLY N: 7037627.91 E: 2382428.17 17' CITY OF SOUTHLAKE UTILITY EASEMENT VOL.8440, PG. 768 D.R.T.C.T. 15' DRAINAGE EASEMENT DOC. NO. D221095079 O.P.R.T.C.T.10' PEDESTRIAN EASEMENT DOC. NO. D207152978 O.P.R.T.C.T. PROPOSED 20' DRAINAGE EASEMENT PROPOSED 15' SEWER EASEMENT PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT EXISTING 20' UTILITY EASEMENT EXISTING 20' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT 5' WALL MAINTENANCE ESMT 5' WALL MAINTENANCE ESMT 50'50'PAE & UDE50'50'50'PAE & UDEPAE & UDEPAE & UDEPAE & UDE 50' PAE & UDE CURVE TABLE CURVE C1 C2 RADIUS 200.00' 296.50' LENGTH 17.89' 75.02' CHORD BEARING S86°54'52"W S36°15'56"E CHORD 17.89' 74.82' DELTA 5°07'35" 14°29'46" TANGENT 8.95' 37.71'BYDATEREVISIONSNo.DATESHEET NUMBER CHECKED BY:SCALE:DESIGNED BY:DRAWN BY:KHA PROJECT6/24/2026PHONE: 972-770-1300 FAX: 972-239-3820WWW.KIMLEY-HORN.COM TX F-928© 2026 KIMLEY-HORN AND ASSOCIATES, INC. LAST SAVED6/24/2026 10:51 AMPLOTTED BYBORAWSKI, ALINA 6/24/2026 10:55 AMDWG PATHC:\ACC\ACCDocs\Kimley-Horn\067545015_TRADEMARK SOUTHLAKE\Project Files\CAD\Private Single Family\PlanSheetsDWG NAMEC-Water-Plan.dwg , [ Plan ]IMAGESXREFS xSite-SF : xSite-Exst-SF : xStrm-SF : xSite-Futr-SF : xBase-PC : xBase-MI : xExBase-MR : xBndry-MR : xUtil-PC : xStrm-PC : xDryUtility-PC : xUtil-MI : xStrm-MI : xUtil-SF : xUtil-GI : x22X34-PSF : xBase-PSF : xEsmt-PSF : xHard13455 NOEL ROAD, TWO GALLERIA OFFICE TOWER,SUITE 700, DALLAS, TX 75240AS NOTEDERGAGBCMDCITY OF SOUTHLAKE, TEXASSHIVERS' FARMPRIVATE SINGLE FAMILYCITY CASE NO. ZA26-00XX 067545015PROPERTY LINE PROPOSED SANITARY SEWER LINE PROPOSED WATER LINE PROPOSED SANITARY SEWER MANHOLE PROPOSED SANITARY SEWER CLEANOUT SANITARY SEWER FLOW DIRECTION PROPOSED FIRE HYDRANT PROPOSED TAPPING SLEEVE & VALVE IRRIGATION SLEEVE WATER METER (TO BE INSTALLED BY THE HOME BUILDER) EXISTING OVERHEAD POWER LINE EXISTING WATER LINE EXISTING SANITARY SEWER LINE EXISTING STORM SEWER LINE EXISTING POWER POLE EXISTING FIRE HYDRANT EXISTING WATER METER EXISTING SANITARY SEWER MANHOLE PEDESTRIAN ACCESS EASEMENT & UTILITY AND DRAINAGE EASEMENT UTILITY LEGEND S PAE & UDE 1.FIRE HYDRANTS, VALVES, FITTINGS, ETC. SHOWN AS A GRAPHICAL REPRESENTATION ONLY. CONTRACTOR TO LOCATE AND CONSTRUCT THESE IMPROVEMENTS BASED ON THE CURRENT CITY/JURISDICTIONAL DESIGN STANDARDS AND DETAILS. CONTRACTOR TO NOTIFY ENGINEER IF ANY DISCREPANCIES ARE DISCOVERED PRIOR TO BEGINNING CONSTRUCTION. 2.ALL WATER MAINS ARE PUBLIC UNLESS OTHERWISE NOTED ON PLANSHEET. 3.WATER AND SANITARY SEWER SEPARATION (VERTICAL AND HORIZONTAL) SHALL BE MAINTAINED IN ACCORDANCE WITH TCEQ REQUIREMENTS. 4.CONTRACTOR TO FIELD VERIFY LOCATION OF EXISTING UTILITIES PRIOR TO CONSTRUCTION. 5.FIRE HYDRANT ASSEMBLY INCLUDES ALL FITTINGS, TEES AND VALVES. 6.ALL FIRE HYDRANTS TO BE LOCATED AT PCCRS OR LOT LINES. 7.ALL WATERLINES ARE 8" UNLESS OTHERWISE NOTED. 8.ALL WATERLINE CURVES ARE CONCENTRIC AND PARALLEL TO THE STREET CENTERLINES UNLESS OTHERWISE NOTED. 9.ALL GATE VALVES AND WATER METERS SHALL BE PLACED CLEAR OF BARRIER-FREE RAMPS. ALL GATE VALVES SHALL BE LOCATED 5' OFF NEAREST FITTING, UNLESS OTHERWISE NOTED. 10.ADJUSTED SERVICES DUE TO CONFLICTS (I.E. MANHOLES, INLETS, TRENCH CONFLICTS OR NON-STANDARD PLACEMENT) = 11.ALL WATER PIPE SHALL BE SDR-18 C-900. ALL FIRE SERVICE LINES SHALL BE SDR-14 C-200. ALL DOMESTIC AND IRRIGATION SERVICE LINE MATERIAL SHALL BE SDR-9, C-200. 12.ALL WATER LINES ARE TO CLEAR CURB INLETS BY AT LEAST 2 FEET VERTICALLY AND HORIZONTALLY. 13.DOUBLE-STRAP-SERVICE SADDLE = DSSS WATER GENERAL NOTES *PROPERTY LINERIGHT-OF-WAY PAVEMENT B-B PROPERTY LINETYPICAL UTILITY LOCATION FIRE HYDRANT WATER SANITARY SEWER STORM SEWER C.L. 3' 5' 6' 2 3 4 5 11 12 13 14 15 WATER LINE ROW LINE ROW LINE 10' S.S. LINE TYPICAL LOT SERVICE DETAIL S.S. SERVICE (4") TO BE LOCATED AT CENTER OF LOT AND WATER SERVICE (1") TO BE LOCATED 10' DOWNSTREAM OF SEWER SERVICE LOT LINELOT LINECALLED 42.5091 CARILLON CROWN, LLC INST. NO. DOC. NO. D222154040 O.P.R.T.C.T. CARILLON PHASE 1A INST.NO. D211101073 P.R.T.C.T. BLOCK A THRASHER ADDITION CAB. 388-202, PG. 73 P.R.T.C.T. BLOCK 4 METAIRIE AT SOUTHLAKE INST. NO. D221095079 O.P.R.T.C.T.KIRKWOOD BOULEVARDPROPOSED ROADWAY IMPROVEMENTS (BY PWC26-0002) (FOR REFERENCE ONLY) PROPOSED COMMERCIAL (BY PWC26-0003) (FOR REFERENCE ONLY) PROPOSED COMMERCIAL (BY PWC26-0003) (FOR REFERENCE ONLY) W KIRKWOOD BOULEVARD UTLEY WAY UTLEY WAYPURYEARPLACE PURYEAR PLACE PURYEAR PLACEPURYEAR PLACEPURYEAR PLACEEXISTINGN. WHITE CHAPEL BOULEVARD(COUNTY ROAD 3016)(FOR REFERENCE ONLY)* * * ** * * * *** NORTH 0 GRAPHIC SCALE IN FEET 60 30 60 120 BM 403 A SQUARE CUT WITH "X"-CUT SET ON A CURB INLET, ON THE NORTHEAST SIDE OF SH 114 FRONTAGE ROAD (NORTHBOUND), 900'+/- NORTHWEST OF THE INTERSECTION OF STATE HIGHWAY NO. 114 AND N. WHITE CHAPEL BOULEVARD. ELEV.=647.93 BM 405 A SQUARE CUT WITH "X"-CUT SET ON THE SOUTHWEST CORNER OF A CURB INLET, 538'+/- WEST OF THE CENTERLINE OF STATE HIGHWAY NO. 114 AND N. WHITE CHAPEL BOULEVARD, 610'+/- OF THE CENTERLINE OF N. WHITE CHAPEL BOULEVARD AND E. KIRKWOOD BOULEVARD. ELEV.=648.94 BENCH MARK LIST WATER PLANC-600 06/29/2026 \\\\\\ \\ \\ \\ \\ \\ \\\\\\\\\ \ \\ \\\\\\8"W 12"W 12"W 12"W12"W12"W12"WUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEOHC UGE UGE UGE UGE UGE UGE UGE UGE UGE UGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGE UGE UGE UGE UGE UGE UGE UGE UGE UGE UGE UGEUGEUGEUGEUGEUGE UGE UGE UGEUGE UGE UGE UGE UGE UGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCU G C UGC UGC UGC UGC UGC UGC UGC UGC UGCUGCUGCUGCUGC UGC UGCUGCUGCUGC UGC UGEUGEUGEUGEUGEUGEUGEUGE UGE UGEUGEUGE UGE UGE UGE P P P P PPP PP P P PP P 8"W8"W8"W8"W 8"W 8"W 8"W 8"W8"SS S W D S T W E E E W WXXXOHEOHEOHEXOHE<<<<<<<<<<<<<<<<<<<<<<<OHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE8"SS F F F D 1182638.431STORM DRAIN MANHOLE GASGAS T T T T T T CBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBL CBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLWV WVXXX FLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFL FL FL FL FL FL FL FLT3PT3PT3PT3P MURANO PLACE (51' RIGHT-OF-WAY) 1234 5 6 7 8 1X-HOA BLOCK C BLOCK B 123456 7 8 9 10 11 12 13 14 15 16 17 1 2 3456789 123 BLOCK B BLOCK B BLOCK B 1X-HOA1X-HOABLOCK D BLOCK E BLOCK E 1X-HOAUTLEY WAY PURYEAR PLACE PURYEAR PLACEPURYEAR PLACEPURYEAR PLACE1X-HOA1X-HOA 1X-HOA 1X-HOA1X-HOA 1X-HOA8"SS 8"SS 8"SS 8"W 8"W 8"W8 "W 8"W 8"W 8"W 8"W 8"W8"WS S S 8"W 8"W 8"W 8"W 8"WSTA: 1+70.33 SEWER E PAV STA 3+87.82 (20.50' RT) PURYEAR PLACE (2) 4' MANHOLE RIM: 653.09'± FL 8" SSWR (E): 645.92' FL 8" SSWR (W): 645.82' N: 7037349.18 E: 2382099.05 STA: 5+04.20 SEWER E PAV STA 7+21.69 (20.50' RT) PURYEAR PLACE (2) 4' MANHOLE RIM: 653.64'± FL 8" SSWR (W): 647.25' N: 7037352.23 E: 2382432.91 ADJUST RIM TO: 652.7 ADJUST RIM TO: 652.0 ADJUST RIM TO: 651.9 ADJUST RIM TO: 652.1 ADJUST RIM TO: 651.4 ADJUST RIM TO: 651.9 ADJUST RIM TO: 651.8 ADJUST RIM TO: 651.1 ADJUST RIM TO: 652.5 W W SSSS SSSSSSSSSSSSSSW W SSSSSSSSSSSSSSSSSSSSSSSSSSSS S S S S S S S S S SS S S S S S S SS S S S ADJUST RIM TO: 652.7 STA: 1+20.00 LAT B-1 PAV STA 5+35.42 (20.50' LT) UTLEY WAY REMOVE PLUG AND CONNECT TO EXISTING STUB FL 8" SSWR (W): 638.38' FL 8" SSWR (W): 638.38' N: 7038129.31 E: 2382250.67 STA: 1+20.00 SEWER E PURYEAR PLACE (2) REMOVE PLUG AND CONNECT TO EXISTING STUB FL 8" SSWR (W): 645.62' FL 8" SSWR (W): 645.62' N: 7037354.79 E: 2382049.04 ADJUST RIM TO: 654.1 3' 44' 43' ADJUST RIM TO: 651.5 EXEXEXEXEXEX EX EX EXEX EXEX EX EX E X EX EX LAT B-1 SEWER E LAT B-1 2+00 3+00 2+00 3+00 4+00 5+00 EXWEST KIRKWOODBOULEVARDWEST KIRKWOOD BOULEVARD N. WHITE CHAPEL BOULEVARD17' CITY OF SOUTHLAKE UTILITY EASEMENT VOL.8440, PG. 768 D.R.T.C.T. 15' DRAINAGE EASEMENT DOC. NO. D221095079 O.P.R.T.C.T.10' PEDESTRIAN EASEMENT DOC. NO. D207152978 O.P.R.T.C.T. STA: 3+06.00 LAT B-1 PAV STA 7+21.42 (20.50' LT) UTLEY WAY 4' MANHOLE RIM: 650.75'± FL 8" SSWR (W): 642.84' N: 7038131.01 E: 2382436.66 PROPOSED 20' DRAINAGE EASEMENT PROPOSED 15' SEWER EASEMENT PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT EXISTING 20' UTILITY EASEMENT EXISTING 20' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT 5' WALL MAINTENANCE ESMT 5' WALL MAINTENANCE ESMT 50'50'PAE & UDE50'50'50' PAE & UDE PAE & UDEPAE & UDEPAE & UDEUTLEY WAY50' PAE & UDE SEWER SERVICE ELEVATION TABLE LOT BLOCK B, LOT 1 BLOCK B, LOT 2 BLOCK B, LOT 3 BLOCK B, LOT 4 BLOCK B, LOT 5 BLOCK B, LOT 6 BLOCK C, LOT 1 BLOCK C, LOT 2 BLOCK C, LOT 3 BLOCK C, LOT 4 BLOCK E, LOT 1 BLOCK E, LOT 2 BLOCK E, LOT 3 BLOCK E, LOT 4 BLOCK E, LOT 5 ALIGNMENT SEWER E SEWER E SEWER E SEWER E SEWER E SEWER E SEWER E SEWER E SEWER E SEWER E LAT B-1 LAT B-1 LAT B-1 LAT B-1 LAT B-1 STATION 4+99.20 4+18.91 3+38.91 2+58.91 1+76.56 1+36.09 4+47.47 3+71.47 2+91.47 2+11.47 2+07.69 2+99.95 3+01.60 2+17.10 1+24.18 GROUND ELEVATION 654.14 654.59 654.77 654.21 653.64 653.62 654.39 654.86 654.47 653.87 653.05 651.48 651.22 652.86 653.35 SURFACE ELEVATION 649.14 649.59 649.77 649.21 648.64 648.62 649.39 649.86 649.47 648.87 648.05 646.48 646.22 647.86 648.35 LENGTH OF PIPE 9.50 RT 9.50 RT 9.50 RT 9.50 RT 9.50 RT 23.79 RT 50.50 LT 50.50 LT 50.50 LT 50.50 LT 50.50 RT 50.50 RT 9.50 LT 9.50 LT 9.50 LT BYDATEREVISIONSNo.DATESHEET NUMBER CHECKED BY:SCALE:DESIGNED BY:DRAWN BY:KHA PROJECT6/24/2026PHONE: 972-770-1300 FAX: 972-239-3820WWW.KIMLEY-HORN.COM TX F-928© 2026 KIMLEY-HORN AND ASSOCIATES, INC. LAST SAVED6/24/2026 10:50 AMPLOTTED BYBORAWSKI, ALINA 6/24/2026 10:55 AMDWG PATHC:\ACC\ACCDocs\Kimley-Horn\067545015_TRADEMARK SOUTHLAKE\Project Files\CAD\Private Single Family\PlanSheetsDWG NAMEC-Sanitary-Plan.dwg , [ Overall Sewer ]IMAGESXREFS xSite-Exst-SF : xStrm-SF : xSite-Futr-SF : xBase-PC : xBase-MI : xExBase-MR : xBndry-MR : xUtil-PC : xStrm-PC : xDryUtility-PC : xUtil-MI : xStrm-MI : xUtil-SF : xUtil-GI : x22X34-PSF : xBase-PSF : xSite-SF : xHard13455 NOEL ROAD, TWO GALLERIA OFFICE TOWER,SUITE 700, DALLAS, TX 75240AS NOTEDERGAGBCMDCITY OF SOUTHLAKE, TEXASSHIVERS' FARMPRIVATE SINGLE FAMILYCITY CASE NO. ZA26-00XX 067545015BM 403 A SQUARE CUT WITH "X"-CUT SET ON A CURB INLET, ON THE NORTHEAST SIDE OF SH 114 FRONTAGE ROAD (NORTHBOUND), 900'+/- NORTHWEST OF THE INTERSECTION OF STATE HIGHWAY NO. 114 AND N. WHITE CHAPEL BOULEVARD. ELEV.=647.93 BM 405 A SQUARE CUT WITH "X"-CUT SET ON THE SOUTHWEST CORNER OF A CURB INLET, 538'+/- WEST OF THE CENTERLINE OF STATE HIGHWAY NO. 114 AND N. WHITE CHAPEL BOULEVARD, 610'+/- OF THE CENTERLINE OF N. WHITE CHAPEL BOULEVARD AND E. KIRKWOOD BOULEVARD. ELEV.=648.94 BENCH MARK LIST CALLED 42.5091 CARILLON CROWN, LLC INST. NO. DOC. NO. D222154040 O.P.R.T.C.T. CARILLON PHASE 1A INST.NO. D211101073 P.R.T.C.T. BLOCK A THRASHER ADDITION CAB. 388-202, PG. 73 P.R.T.C.T. BLOCK 4 METAIRIE AT SOUTHLAKE INST. NO. D221095079 O.P.R.T.C.T. PROPOSED COMMERCIAL (BY PWC26-0003) (FOR REFERENCE ONLY) 1.WATER AND SANITARY SEWER SEPARATION (VERTICAL AND HORIZONTAL) SHALL BE MAINTAINED IN ACCORDANCE WITH TCEQ REQUIREMENTS. 2.CONTRACTOR TO FIELD VERIFY LOCATION OF EXISTING UTILITIES PRIOR TO CONSTRUCTION. 3.ALL SANITARY SEWER LINES ARE 8" UNLESS OTHERWISE NOTED. 4.ADJUSTED SERVICES DUE TO CONFLICTS (I.E. MANHOLES, INLETS, TRENCH CONFLICTS OR NON-STANDARD PLACEMENT) = 5.ALL SEWER SERVICES ARE DIRECTED TO CENTER OF LOT UNLESS OTHERWISE DIMENSIONED. 6.SANITARY SEWER SERVICES TO BE INSTALLED BELOW WATER MAINS. 7.SEWER SERVICE CLEANOUTS TO BE PROVIDED ON ALL SERVICES AND LOCATED AT THE ROW LINE. 8.SEWER SERVICES BY SEPARATE PLANS (PWC26-0001) = 9.SEWER MAINS DENOTED WITH 'EX' ARE PROPOSED WITH SEPARATE PLANS (PWC26-0001). SEWER GENERAL NOTES *PROPERTY LINERIGHT-OF-WAY PAVEMENT B-B PROPERTY LINETYPICAL UTILITY LOCATION FIRE HYDRANT WATER SANITARY SEWER STORM SEWER C.L. 3' 5' 6' 2 3 4 5 11 12 13 14 15 WATER LINE ROW LINE ROW LINE 10' S.S. LINE TYPICAL LOT SERVICE DETAIL S.S. SERVICE (4") TO BE LOCATED AT CENTER OF LOT AND WATER SERVICE (1") TO BE LOCATED 10' UPSTREAM OF SEWER SERVICE LOT LINELOT LINEPROPOSED COMMERCIAL (BY PWC26-0003) (FOR REFERENCE ONLY) PROPOSED ROADWAY IMPROVEMENTS (BY PWC26-0002) (FOR REFERENCE ONLY) 10' PRIVATE DRAINAGE ESMT * * *SANITARYSEWER PLANC-500 NORTH 0 GRAPHIC SCALE IN FEET 60 30 60 120 PROPERTY LINE PROPOSED SANITARY SEWER LINE PROPOSED WATER LINE PROPOSED SANITARY SEWER MANHOLE PROPOSED SANITARY SEWER CLEANOUT SANITARY SEWER FLOW DIRECTION PROPOSED FIRE HYDRANT PROPOSED TAPPING SLEEVE & VALVE IRRIGATION SLEEVE WATER METER (TO BE INSTALLED BY THE HOME BUILDER) EXISTING OVERHEAD POWER LINE EXISTING WATER LINE EXISTING SANITARY SEWER LINE EXISTING STORM SEWER LINE EXISTING POWER POLE EXISTING FIRE HYDRANT EXISTING WATER METER EXISTING SANITARY SEWER MANHOLE PEDESTRIAN ACCESS EASEMENT & UTILITY AND DRAINAGE EASEMENT UTILITY LEGEND S PAE & UDE 06/29/2026 1 2 345678 9 12 3 BLOCK D BLOCK E BLOCK E 1X-HOA1X-HOA 1X-HOA S 8"W 8"W 8"W 8"W 8"W 8"W12"W12"W12"W12"W8"WUGE UGE UGE UGE UGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGE UGE UGE UGE UGE UGE UGE UGE UGE UGE UGE P P P XXXXXOHEOHEOHEOHEOHEXOHE<<<<<<<<<<<<<<<OHEOHEOHEOHEOHEOHEOHEOHEOHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHEOHEOHEF D 1182638.431STORM DRAIN MANHOLE GASGASGASGASGASGAS GAS GAS T T T CBLCBLCBLCBL CBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLWV WVXXXXXX CARILLON PHASE 1A INST.NO. D211101073 P.R.T.C.T. BLOCK A THRASHER ADDITION CAB. 388-202, PG. 73 P.R.T.C.T. BLOCK 4 METAIRIE AT SOUTHLAKE INST. NO. D221095079 O.P.R.T.C.T. STA: 7+34.94 STORM C PAV STA: 1+72.00 (7.07' RT) UTLEY WAY (1) N: 7037953.10 E: 2382259.85 45° BEND STA: 7+18.44 STORM C STA: 1+00.00 LAT C-4 PAV STA: 1+58.43 UTLEY WAY (1) N: 7037939.47 E: 2382252.90 60° WYE CONNECTION STA: 1+27.14 LAT C-4 PAV STA: 1+72.00 (23.50' LT) UTLEY WAY (1) N: 7037952.82 E: 2382229.28 10' STD CURB INLET TC: 650.56 : 646.56 STA: 7+51.37 STORM C PAV STA: 1+72.00 (23.50' RT) UTLEY WAY (1) N: 7037953.25 E: 2382276.27 10' STD CURB INLET TC: 650.44 : 646.44 STA: 7+24.94 STORM C PAV STA: 1+64.93 UTLEY WAY (1) N: 7037945.97 E: 2382252.84 45° BEND STA: 7+15.01 STORM C PAV STA: 1+55.00 UTLEY WAY (1) N: 7037936.04 E: 2382252.93 CONNECT TO EX. 18" RCP WITH 60° BEND EX. 18" RCP STORM F 18" RCP STA: 1+22.22 STORM F N: 7038110.86 E: 2382483.93 45° BEND STA: 1+12.22 STORM F N: 7038117.97 E: 2382490.96 CONNECT TO EX. 18" RCP STA: 1+69.30 STORM F PAV STA: 7+21.42 (0.00' ) UTLEY WAY N: 7038110.51 E: 2382436.85 10' STD CURB INLET TC: 650.34 : 646.34 STA: 1+49.29 STORM F N: 7038110.68 E: 2382456.86 2'X2' WYE INLET THROAT: 650.00  (OUT): 637.32 STA: 1+17.98 LAT A-3C PAV STA: 1+66.00 (15.50' LT) UTLEY WAY N: 7038120.95 E: 2381881.31 10' STD CURB INLET TC: 651.26 : 647.26 STA: 1+21.92 LAT A-3B PAV STA: 1+85.00 (15.50' RT) UTLEY WAY N: 7038090.12 E: 2381900.59 10' STD CURB INLET TC: 651.17 : 647.17 STA: 3+48.85 LAT A-3 PAV STA: 3+22.00 (15.50' RT) UTLEY WAY N: 7038091.37 E: 2382037.59 10' STD CURB INLET TC: 651.19 : 647.19 STA: 1+15.50 LAT A-3A PAV STA: 3+22.00 (15.50' LT) UTLEY WAY N: 7038122.37 E: 2382037.31 10' STD CURB INLET TC: 651.19 : 647.19 STA: 1+68.23 LAT A-3 STA: 1+00.00 LAT A-3C PAV STA: 1+56.88 UTLEY WAY N: 7038105.36 E: 2381872.33 CONNECT TO EX. 18" RCP WITH 60° WYE CONNECTION STA: 1+80.85 LAT A-3 STA: 1+00.00 LAT A-3B PAV STA: 1+69.50 UTLEY WAY N: 7038105.48 E: 2381884.95 45° WYE CONNECTION STA: 3+33.35 LAT A-3 STA: 1+00.00 LAT A-3A PAV STA: 3+22.00 UTLEY WAY N: 7038106.87 E: 2382037.45 4'X4' STORM SEWER JUNCTION BOX RIM: 651.11 EX. 24" RCP LAT A-3 24" RCP STORM C 18" RCP 17' CITY OF SOUTHLAKE UTILITY EASEMENT VOL.8440, PG. 768 D.R.T.C.T. 15' DRAINAGE EASEMENT DOC. NO. D221095079 O.P.R.T.C.T. EX. 18" RCP 10' PEDESTRIAN EASEMENT DOC. NO. D207152978 O.P.R.T.C.T.CITY OF SOUTHLAKE UTILITY EASEMENT VOL. 8405, PG. 1444 D.R.T.C.T. PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT EXISTING 20' UTILITY EASEMENT50'50'50' PAE & UDE PAE & UDEPAE & UDE12"W 12"W 12"W 12"W12"WUGE<OHEF GASTCBLCBLCBLCBLCBLSTA: 1+67.54 LAT C-3 PAV STA: 2+42.07 PURYEAR PLACE (3) STA: 1+55.00 LAT C-3 PAV STA: 2+54.61 PURYEAR PLACE (3) N: 7037825.22 E: 2382174.99 EX. 18" RCP CALLED 1.82 ACRES PANORAMA PROPERTIES, LTD. DOC. NO. D206290483 O.P.R.T.C.T.BYDATEREVISIONSNo.DATESHEET NUMBER CHECKED BY:SCALE:DESIGNED BY:DRAWN BY:KHA PROJECT6/24/2026PHONE: 972-770-1300 FAX: 972-239-3820WWW.KIMLEY-HORN.COM TX F-928© 2026 KIMLEY-HORN AND ASSOCIATES, INC. LAST SAVED6/24/2026 10:49 AMPLOTTED BYBORAWSKI, ALINA 6/24/2026 10:54 AMDWG PATHC:\ACC\ACCDocs\Kimley-Horn\067545015_TRADEMARK SOUTHLAKE\Project Files\CAD\Private Single Family\PlanSheetsDWG NAMEC-Storm-Plan.dwg , [ Storm Plan ]IMAGESXREFS xSite-SF : xSite-Exst-SF : xStrm-SF : xSite-Futr-SF : xBase-PC : xBase-MI : xExBase-MR : xBndry-MR : xUtil-PC : xStrm-PC : xDryUtility-PC : xUtil-MI : xStrm-MI : xUtil-SF : xBase-PSF : x22X34-PSF : xEsmt-PSF : xHard13455 NOEL ROAD, TWO GALLERIA OFFICE TOWER,SUITE 700, DALLAS, TX 75240AS NOTEDERGAGBCMDCITY OF SOUTHLAKE, TEXASSHIVERS' FARMPRIVATE SINGLE FAMILYCITY CASE NO. ZA26-00XX 067545015BM 403 A SQUARE CUT WITH "X"-CUT SET ON A CURB INLET, ON THE NORTHEAST SIDE OF SH 114 FRONTAGE ROAD (NORTHBOUND), 900'+/- NORTHWEST OF THE INTERSECTION OF STATE HIGHWAY NO. 114 AND N. WHITE CHAPEL BOULEVARD. ELEV.=647.93 BM 405 A SQUARE CUT WITH "X"-CUT SET ON THE SOUTHWEST CORNER OF A CURB INLET, 538'+/- WEST OF THE CENTERLINE OF STATE HIGHWAY NO. 114 AND N. WHITE CHAPEL BOULEVARD, 610'+/- OF THE CENTERLINE OF N. WHITE CHAPEL BOULEVARD AND E. KIRKWOOD BOULEVARD. ELEV.=648.94 BENCH MARK LIST MATCH LINE SEE SHEET C-301 10' PRIVATE DRAINAGE ESMT (SEE NOTE 8) EXISTING 20' ELECTRICAL ESMT EXISTINGN. WHITE CHAPEL BOULEVARD(COUNTY ROAD 3016)(FOR REFERENCE ONLY)5' WALL MAINTENANCE ESMT 15' DRAINAGE ESMT W KIRKWOOD BOULEVARDW KIRKWOOD BOULEVARD0 GRAPHIC SCALE IN FEET 40 20 40 80 NORTH STORM PLAN(1 OF 2)C-402 A-3C A-3B A-3 A-3A C-4 C-5 LEGEND S MH PROPERTY LINE PROPOSED STORM PIPE PROPOSED SANITARY SEWER LINE PROPOSED WATER LINE PROPOSED FIRE HYDRANT PROPOSED CURB INLET PROPOSED SANITARY SEWER MANHOLE PROPOSED STORM MANHOLE PROPOSED GRATE INLET JUNCTION BOX PEDESTRIAN ACCESS EASEMENT & UTILITY AND DRAINAGE EASEMENT FH CI SS W D STMH GI JB PAE & UDE 06/29/2026 \\1234 5 6 7 8 1X-HOA BLOCK C BLOCK B 123456 7 8 9 10 11 12 13 14 15 16 17 BLOCK B BLOCK B BLOCK B 1X-HOA1X-HOA1X-HOA1X-HOA1X-HOA 1X-HOASTA: 1+15.50 LAT G-1 PAV STA: 2+67.00 (15.50' LT) PURYEAR PLACE (2) N: 7037442.96 E: 2382030.57 10' STD CURB INLET TC: 651.79 : 647.798"W 8"W 8"W 8"W8"W8 "W8"W 8"W 8"W 8"W 8"W 8"W 8"W 8"W8"W8"WS S 8"W 8"W 12"W 12"W 12"W 12"W 12"W 12"W12"WUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGE UGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGE UGE UGE UGE UGE UGE UGE UGE UGEUGEUGEUGE UGE UGE UGE UGE UGEUGEUGEUGEUGEUGEUGE UGE UGE UGE UGE UGE UGEUGEUGEUGE UGE UGE UGE U G E UGE UGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGEUGE UG E UGEUGEUGEUGE UGE UGE UGE UGE UGEP PPP PP P P PP P 8"SS8"W8"W8"W8"W8"W 8"W 8"W 8"W 8"W 8"W8"SS8"SSS DWFWD S T W E W W<<<<<<<<<<<<<<<<<<<<<BM 404 OHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHE8"SS F F XGASGASGASGAS GAS T T CBLCBLCBLCBLCBL CBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBL CBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLCBLSTA: 3+23.81 STORM E PAV STA: 1+06.07 PURYEAR PLACE (2) N: 7037558.73 E: 2381914.56 45° BEND PC STA: 8+76.66 STORM E PAV STA: 6+50.91 PURYEAR PLACE N: 7037672.82 E: 2382417.80 45° BEND STA: 9+21.15 STORM E PAV STA: 3+68.75 PURYEAR PLACE (1) N: 7037641.64 E: 2382449.55 45° BEND STA: 10+57.96 STORM E PAV STA: 2+31.95 PURYEAR PLACE (1) N: 7037504.84 E: 2382450.79 60° BEND STA: 1+46.47 STORM E N: 7037477.12 E: 2381757.12 CONNECT TO EX. 42" RCP STA: 1+15.50 LAT E-1 PAV STA: 1+55.00 (15.50' RT) PURYEAR PLACE N: 7037599.39 E: 2381951.13 10' STD CURB INLET TC: 651.33 : 647.33 STA: 1+15.50 LAT E-2 PAV STA: 1+55.00 (15.50' LT) PURYEAR PLACE N: 7037619.74 E: 2381927.75 10' STD CURB INLET TC: 651.33 : 647.33 STA: 1+15.50 LAT E-3 PAV STA: 3+60.00 (15.50' RT) PURYEAR PLACE N: 7037654.67 E: 2382127.04 10' STD CURB INLET TC: 651.29 : 647.29 STA: 1+15.50 LAT E-4 PAV STA: 3+60.00 (15.50' LT) PURYEAR PLACE N: 7037685.66 E: 2382126.76 10' STD CURB INLET TC: 651.29 : 647.29 STA: 10+75.85 STORM E PAV STA: 2+23.00 (15.50' RT) PURYEAR PLACE (1) N: 7037496.04 E: 2382466.37 10' STD CURB INLET TC: 652.26 : 648.26 STA: 1+21.92 LAT E-5 PAV STA: 2+23.00 (15.50' LT) PURYEAR PLACE (1) N: 7037495.75 E: 2382435.37 10' STD CURB INLET TC: 652.26 : 648.26 STA: 5+85.75 STORM E STA: 1+00.00 LAT E-4 STA: 1+00.00 LAT E-3 PAV STA: 3+60.00 PURYEAR PLACE N: 7037670.16 E: 2382126.90 5'X5' STORM SEWER JUNCTION BOX RIM: 651.21 STA: 10+51.40 STORM E STA: 1+00.00 LAT E-5 PAV STA: 2+38.50 PURYEAR PLACE (1) N: 7037511.39 E: 2382450.73 45° WYE CONNECTION STA: 1+61.16 LAT C-3 STA: 1+00.00 LAT C-3A PAV STA: 2+48.45 PURYEAR PLACE (3) N: 7037819.06 E: 2382175.04 60° WYE CONNECTION STA: 1+93.76 LAT C-3 PAV STA: 2+35.00 (23.29' LT) PURYEAR PLACE (3) N: 7037805.40 E: 2382151.87 10' STD CURB INLET TC: 651.08 : 647.08 STA: 1+26.90 LAT C-3A PAV STA: 2+35.00 (23.29' RT) PURYEAR PLACE (3) N: 7037805.82 E: 2382198.46 10' STD CURB INLET TC: 650.94 : 646.94 STA: 1+67.54 LAT C-3 PAV STA: 2+42.07 PURYEAR PLACE (3) N: 7037812.68 E: 2382175.10 45° BEND STA: 1+77.54 LAT C-3 PAV STA: 2+35.00 (7.07' LT) PURYEAR PLACE (3) N: 7037805.55 E: 2382168.10 45° BEND STA: 1+55.00 LAT C-3 PAV STA: 2+54.61 PURYEAR PLACE (3) N: 7037825.22 E: 2382174.99 CONNECT TO EX. 18" RCP STA: 3+80.75 STORM E STA: 1+00.00 LAT E-2 STA: 1+00.00 LAT E-1 PAV STA: 1+55.00 PURYEAR PLACE N: 7037609.56 E: 2381939.44 6'X6' STORM SEWER JUNCTION BOX RIM: 651.25 PCC STA: 3+09.80 STORM E STA: 1+00.00 STORM G PAV STA: 1+02.18 (13.46' RT) PURYEAR PLACE (2) N: 7037552.28 E: 2381902.12 45° WYE CONNECTION FLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFLFL FL FL FL FL FL FL FL FL FL T3PT3PT3P PROPOSED COMMERCIAL (FOR REFERENCE ONLY) PT STA: 5+28.68 STOR M E 42" R C P STO R M E 36" R C P STORM E 21" RCP S TO RM E 2 1 " R C P STORM E21" RCPC1C2 LAT C-3 18" RCP EX. 18" RCP 24" R C P S TORM G 2 4 " R C PSTORM E42" RCPC3PC STA: 1+91.38 PT STA: 2+60.95 STA: 2+83.79 STORM G PAV STA: 2+67.00 (15.50' RT) PURYEAR PLACE (2) N: 7037427.92 E: 2382003.46 10' STD CURB INLET TC: 651.79 : 647.79 STA: 2+68.29 STORM G STA: 1+00.00 LAT G-1 PAV STA: 2+67.00 PURYEAR PLACE (2) N: 7037435.44 E: 2382017.01 4'X4' STORM SEWER JUNCTION BOX RIM: 651.71 STA: 1+27.87 STORM G PAV STA: 1+26.58 PURYEAR PLACE (2) N: 7037543.86 E: 2381928.68 30° BEND PROPOSED 20' DRAINAGE EASEMENT PROPOSED 15' SEWER EASEMENT PROPOSED 5' UTILITY EASEMENT PROPOSED 5' UTILITY EASEMENT EXISTING 20' UTILITY EASEMENT PROPOSED 15' SEWER EASEMENT PROPOSED 5' UTILITY EASEMENT 50'50'50'PAE & UDEPAE & UDEPAE & UDE 8"WUGE<<OHEGASCBLCBLCBLCBLCBLCBLWV STA: 1+00.00 LAT C-4 PAV STA: 1+58.43 UTLEY WAY (1) N: 7037939.47 E: 2382252.90 60° WYE CONNECTION PAV STA: 1+55.00 UTLEY WAY (1) N: 7037936.04 E: 2382252.93 CONNECT TO EX. 18" RCP WITH 60° BEND EX. 18" RCP EXISTING 20' UTILITY EASEMENT CURVE TABLE CURVE C1 C2 RADIUS 150.00' 175.00' LENGTH 56.93' 147.93' CHORD BEARING N26°04'56"E N65°15'40"E CHORD 56.59' 143.57' DELTA 21°44'50" 48°25'59" TANGENT 28.81' 78.71' CURVE TABLE CURVE C3 RADIUS 275.00' LENGTH 69.58' CHORD BEARING S36°15'56"E CHORD 69.39' DELTA 14°29'46" TANGENT 34.97'BYDATEREVISIONSNo.DATESHEET NUMBER CHECKED BY:SCALE:DESIGNED BY:DRAWN BY:KHA PROJECT6/24/2026PHONE: 972-770-1300 FAX: 972-239-3820WWW.KIMLEY-HORN.COM TX F-928© 2026 KIMLEY-HORN AND ASSOCIATES, INC. LAST SAVED6/24/2026 10:49 AMPLOTTED BYBORAWSKI, ALINA 6/24/2026 10:54 AMDWG PATHC:\ACC\ACCDocs\Kimley-Horn\067545015_TRADEMARK SOUTHLAKE\Project Files\CAD\Private Single Family\PlanSheetsDWG NAMEC-Storm-Plan.dwg , [ Storm Plan (2) ]IMAGESXREFS xSite-SF : xSite-Exst-SF : xStrm-SF : xSite-Futr-SF : xBase-PC : xBase-MI : xExBase-MR : xBndry-MR : xUtil-PC : xStrm-PC : xDryUtility-PC : xUtil-MI : xStrm-MI : xUtil-SF : xBase-PSF : x22X34-PSF : xEsmt-PSF : xHard13455 NOEL ROAD, TWO GALLERIA OFFICE TOWER,SUITE 700, DALLAS, TX 75240AS NOTEDERGAGBCMDCITY OF SOUTHLAKE, TEXASSHIVERS' FARMPRIVATE SINGLE FAMILYCITY CASE NO. ZA26-00XX 067545015BM 403 A SQUARE CUT WITH "X"-CUT SET ON A CURB INLET, ON THE NORTHEAST SIDE OF SH 114 FRONTAGE ROAD (NORTHBOUND), 900'+/- NORTHWEST OF THE INTERSECTION OF STATE HIGHWAY NO. 114 AND N. WHITE CHAPEL BOULEVARD. ELEV.=647.93 BM 405 A SQUARE CUT WITH "X"-CUT SET ON THE SOUTHWEST CORNER OF A CURB INLET, 538'+/- WEST OF THE CENTERLINE OF STATE HIGHWAY NO. 114 AND N. WHITE CHAPEL BOULEVARD, 610'+/- OF THE CENTERLINE OF N. WHITE CHAPEL BOULEVARD AND E. KIRKWOOD BOULEVARD. ELEV.=648.94 BENCH MARK LIST MATCH LINE SEE SHEET C-300 W KIRKWOOD BOULEVARD STORM PLAN(2 OF 2)C-403 NORTH 0 GRAPHIC SCALE IN FEET 40 20 40 80 G-2 G-1 E-1 E-2 E-5 E-6 E-4 E-3 C-3 C-3A LEGEND S MH PROPERTY LINE PROPOSED STORM PIPE PROPOSED SANITARY SEWER LINE PROPOSED WATER LINE PROPOSED FIRE HYDRANT PROPOSED CURB INLET PROPOSED SANITARY SEWER MANHOLE PROPOSED STORM MANHOLE PROPOSED GRATE INLET JUNCTION BOX PEDESTRIAN ACCESS EASEMENT & UTILITY AND DRAINAGE EASEMENT FH CI SS W D STMH GI JB PAE & UDE EXISTINGN. WHITE CHAPEL BOULEVARD(COUNTY ROAD 3016)(FOR REFERENCE ONLY)06/29/2026 123456781X-HOABLOCK CBLOCK B1234567891011121314151617123456789123BLOCK BBLOCK BBLOCK B1X-HOA 1X-HOA BLOCK DBLOCK EBLOCK E1X-HOA 1X-HOA 1X-HOA1X-HOA1X-HOA1X-HOA1X-HOAFLFL\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\FL FL FL FL FL FL FL FL FLFLFL FLFLFLFLFLFLFLFLFL FL FL FL FL FL FL FLFLFLFLFL FLFLFLFLWDSTWEEEWWOHE OHE OHE OHEBM 404OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHE OHEOHEOHEOHEOHEOHEOHEOHEOHEOHEOHED1182 638. 43 1STORM D RA IN MAN HOL E TTTTTT17' CITY OF SOUTHLAKEUTILITY EASEMENTVOL.8440, PG. 768D.R.T.C.T.CITY OF SOUTHLAKEUTILITY EASEMENTVOL. 8405, PG. 1444D.R.T.C.T.15' DRAINAGE EASEMENTDOC. NO. D221095079O.P.R.T.C.T.BLOCK ATHRASHER ADDITIONCAB. 388-202, PG. 73P.R.T.C.T.CARILLON PHASE 1AINST.NO. D211101073P.R.T.C.T.BLOCK 4METAIRIE AT SOUTHLAKEINST. NO. D221095079O.P.R.T.C.T.LOT 8LOT 7LOT 6LOT 5LOT 4LOT 3LOT 2LOT 1EX. 44' ROW DEDICATIONBY CARILLON PARC PHASE 1APROPOSED ACCESSIBLEROUTE (TYP.)PROPOSED ACCESSIBLEROUTE (TYP.)PROPOSED5' SIDEWALKPROPOSED8' SIDEWALKPROPOSED5' SIDEWALKPROPOSED5' SIDEWALKPROPOSED8' SIDEWALKPROPOSED8' SIDEWALKPROPOSED8' SIDEWALKPROPOSED5' SIDEWALKPROPOSED5' SIDEWALKPROPOSED5' SIDEWALKPROPOSED 5'SIDEWALKPROPOSED5' SIDEWALKPROPOSED8' SIDEWALKPROPOSED 8'SIDEWALKKIRKWOOD BOULEVARD(A VARIABLE WIDTH PUBLIC RIGHT-OF-WAY)WEST KIRKWOOD BOULEVARD(A VARIABLE WIDTH PUBLIC RIGHT-OF-WAY)EAST KIRKWOODBOULEVARD(A VARIABLE WIDTH PUBLIC RIGHT-OF-WAY)VICENZA DRIVE (51' RIGHT-OF-WAY)MURANO PLACE(51' RIGHT-OF-WAY)PURYEAR PLACEUTLEY WAYN WHITE CHAPEL BLVD99' ROW55'HALF ROWDEDICATIONBY DATE REVISIONSNo.DATESHEET NUMBERCHECKED BY: SCALE: DESIGNED BY: DRAWN BY: KHA PROJECT 6/24/2026 PHONE: 972-770-1300 FAX: 972-239-3820 WWW.KIMLEY-HORN.COM TX F-928 © 2026 KIMLEY-HORN AND ASSOCIATES, INC. LAST SAVED 6/24/2026 10:52 AMPLOTTED BY BORAWSKI, ALINA 6/24/2026 10:56 AMDWG PATH C:\ACC\ACCDocs\Kimley-Horn\067545015_TRADEMARK SOUTHLAKE\Project Files\CAD\Private Single Family\PlanSheetsDWG NAME C-Ped Access-Plan.dwg , [ 2 ]IMAGESXREFS xEsmt-GI : xBase-MI : xDryUtility-MI : xEsmt-MI : xBndry-MR : xExBase-MR : xBase-PC : xHardscape-GI : xHardscape-MI : xHard : xHatch-PC : xHatch-MI : xHatch-GI : xBase-GI : xBase-PSF : x22X34-PSF : xHatch-PSF 13455 NOEL ROAD, TWO GALLERIA OFFICE TOWER, SUITE 700, DALLAS, TX 75240 AS NOTED ERG AGB CMDCITY OF SOUTHLAKE, TEXAS SHIVERS' FARM PRIVATE SINGLE FAMILYCITY CASE NO. ZA26-00XX067545015BM 403A SQUARE CUT WITH "X"-CUT SET ON A CURBINLET, ON THE NORTHEAST SIDE OF SH 114FRONTAGE ROAD (NORTHBOUND), 900'+/-NORTHWEST OF THE INTERSECTION OF STATEHIGHWAY NO. 114 AND N. WHITE CHAPELBOULEVARD.ELEV.=647.93BM 405A SQUARE CUT WITH "X"-CUT SET ON THESOUTHWEST CORNER OF A CURB INLET, 538'+/-WEST OF THE CENTERLINE OF STATE HIGHWAYNO. 114 AND N. WHITE CHAPEL BOULEVARD,610'+/- OF THE CENTERLINE OF N. WHITECHAPEL BOULEVARD AND E. KIRKWOODBOULEVARD.ELEV.=648.94BENCH MARK LISTNORTH1.ALL SIGNAGE IS APPROVED VIA SEPARATE PERMITTING PROCESS2.PARKING SPACE RETURN RADII ARE 3' OR 10' UNLESS OTHERWISE NOTED3.DUMPSTER ENCLOSURES SHOULD NOT BE SEEN FROM THE PUBLICRIGHT-OF-WAY. SCREENING OF THE DUMPSTERS SHALL BE OF THE SAMEMASONRY MATERIAL AS THE PRIMARY STRUCTURE AND BE A MINIMUM OFEIGHT (8) FEET IN HEIGHT. SOLID METAL GATES SHALL BE AFFIXED TO THEOPENING AND SHALL BE CLOSED AT ALL TIMES EXCEPT WHEN BEINGSERVICED4.ALL LIGHT SOURCES, INCLUDING WALL PACKS, SHALL BE FULL CUT-OFFS (I.E.RECESSED/SHIELDED)5.ROOF-MOUNTED MECHANICAL EQUIPMENT SHALL BE SUFFICIENTLYSCREENED FROM VIEW BY PARAPET WALLS, AND GROUND MOUNTEDEQUIPMENT SHALL BE SCREENED BY MASONRY WING WALLS THAT MATCHTHE MATERIAL OF THE PRIMARY BUILDING OR ADEQUATE LANDSCAPING6.ALL STRIPING IN PARKING LOTS SHALL BE WHITE7.HANDICAPPED ACCESS RAMPS SHALL BE PAINTED OR CONSTRUCTED OFCONTRASTING COLORS FROM THE STANDARD PAVEMENT BUT SHALL NOT BEIN COLORS THAT ARE CONSIDERED BRIGHT, NEON, OR GARISH8.FIRE APPARATUS ACCESS ROADS TO BE AN ALL-WEATHER SURFACE,ASPHALT OR CONCRETE, 24 FEET WIDE AND ABLE TO SUPPORT THEIMPOSED LOAD OF FIRE APPARATUS. (MINIMUM OF 85,000 POUNDS GVW).CITY SITE PLAN NOTES0GRAPHIC SCALE IN FEET60 3060120LEGENDPROPERTY LINEPROPOSED SIDEWALKPROPOSED PUBLIC 8' SIDEWALKPROPOSED PUBLIC 5' SIDEWALKPROPOSED PRIVATE SIDEWALKLIGHT DUTY CONCRETE PAVEMENTHEAVY DUTY CONCRETE PAVEMENTPUBLIC CONCRETE PAVEMENTPEDESTRIAN ACCESS EXHIBITC-EX